ID: 987409078

View in Genome Browser
Species Human (GRCh38)
Location 5:17597456-17597478
Sequence GACCCGCAACGCGTGCTCTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987409074_987409078 -4 Left 987409074 5:17597437-17597459 CCAGTGATAGCCCGCATCAGACC No data
Right 987409078 5:17597456-17597478 GACCCGCAACGCGTGCTCTCGGG No data
987409072_987409078 10 Left 987409072 5:17597423-17597445 CCGACACCGAACTGCCAGTGATA No data
Right 987409078 5:17597456-17597478 GACCCGCAACGCGTGCTCTCGGG No data
987409073_987409078 4 Left 987409073 5:17597429-17597451 CCGAACTGCCAGTGATAGCCCGC No data
Right 987409078 5:17597456-17597478 GACCCGCAACGCGTGCTCTCGGG No data
987409071_987409078 19 Left 987409071 5:17597414-17597436 CCGCGTTCTCCGACACCGAACTG No data
Right 987409078 5:17597456-17597478 GACCCGCAACGCGTGCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987409078 Original CRISPR GACCCGCAACGCGTGCTCTC GGG Intergenic