ID: 987411007

View in Genome Browser
Species Human (GRCh38)
Location 5:17615027-17615049
Sequence CCTTTTGCTGGCGGCTTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987411000_987411007 -6 Left 987411000 5:17615010-17615032 CCTCCTGTAGGCCGCGCCCTTTT 0: 1
1: 1
2: 3
3: 5
4: 52
Right 987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG No data
987410999_987411007 -5 Left 987410999 5:17615009-17615031 CCCTCCTGTAGGCCGCGCCCTTT 0: 1
1: 1
2: 3
3: 3
4: 75
Right 987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG No data
987411001_987411007 -9 Left 987411001 5:17615013-17615035 CCTGTAGGCCGCGCCCTTTTGCT 0: 1
1: 0
2: 2
3: 4
4: 28
Right 987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG No data
987410997_987411007 19 Left 987410997 5:17614985-17615007 CCTGTAGCGGTGAGGCTTCTTGA No data
Right 987411007 5:17615027-17615049 CCTTTTGCTGGCGGCTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987411007 Original CRISPR CCTTTTGCTGGCGGCTTTAG TGG Intergenic
No off target data available for this crispr