ID: 987412918

View in Genome Browser
Species Human (GRCh38)
Location 5:17632438-17632460
Sequence GACCCGCAATGCGTGCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 9, 3: 6, 4: 25}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987412918_987412923 19 Left 987412918 5:17632438-17632460 CCCAAGAGCACGCATTGCGGGTC 0: 1
1: 0
2: 9
3: 6
4: 25
Right 987412923 5:17632480-17632502 CAGTTCGGTGTCTGAGAACGCGG No data
987412918_987412922 4 Left 987412918 5:17632438-17632460 CCCAAGAGCACGCATTGCGGGTC 0: 1
1: 0
2: 9
3: 6
4: 25
Right 987412922 5:17632465-17632487 GCGGTCTATCACTGGCAGTTCGG 0: 1
1: 10
2: 2
3: 3
4: 40
987412918_987412921 -4 Left 987412918 5:17632438-17632460 CCCAAGAGCACGCATTGCGGGTC 0: 1
1: 0
2: 9
3: 6
4: 25
Right 987412921 5:17632457-17632479 GGTCTGATGCGGTCTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987412918 Original CRISPR GACCCGCAATGCGTGCTCTT GGG (reversed) Intergenic