ID: 987414288

View in Genome Browser
Species Human (GRCh38)
Location 5:17647099-17647121
Sequence CCCAGGAAGTCTAAGGTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987414281_987414288 26 Left 987414281 5:17647050-17647072 CCTGTGAGCCAAGCTGCATTGAT No data
Right 987414288 5:17647099-17647121 CCCAGGAAGTCTAAGGTTCCAGG No data
987414282_987414288 18 Left 987414282 5:17647058-17647080 CCAAGCTGCATTGATTGCTATCT No data
Right 987414288 5:17647099-17647121 CCCAGGAAGTCTAAGGTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987414288 Original CRISPR CCCAGGAAGTCTAAGGTTCC AGG Intergenic
No off target data available for this crispr