ID: 987414321

View in Genome Browser
Species Human (GRCh38)
Location 5:17647357-17647379
Sequence CCCTATCCACAGGATGTTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987414318_987414321 21 Left 987414318 5:17647313-17647335 CCATAGTCTCTTAAAAGGGTTTC No data
Right 987414321 5:17647357-17647379 CCCTATCCACAGGATGTTCAAGG No data
987414317_987414321 24 Left 987414317 5:17647310-17647332 CCACCATAGTCTCTTAAAAGGGT No data
Right 987414321 5:17647357-17647379 CCCTATCCACAGGATGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987414321 Original CRISPR CCCTATCCACAGGATGTTCA AGG Intergenic
No off target data available for this crispr