ID: 987414550

View in Genome Browser
Species Human (GRCh38)
Location 5:17649227-17649249
Sequence TGCAGGAGGAACTGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 12, 2: 10, 3: 63, 4: 646}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987414550_987414557 19 Left 987414550 5:17649227-17649249 CCTCAGCCTCAGTTCCTCCTGCA 0: 1
1: 12
2: 10
3: 63
4: 646
Right 987414557 5:17649269-17649291 ATACCAAAGGAAAGAAGAAGAGG 0: 1
1: 2
2: 6
3: 78
4: 878
987414550_987414556 6 Left 987414550 5:17649227-17649249 CCTCAGCCTCAGTTCCTCCTGCA 0: 1
1: 12
2: 10
3: 63
4: 646
Right 987414556 5:17649256-17649278 AAATGGAAAACAGATACCAAAGG 0: 1
1: 0
2: 2
3: 64
4: 624

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987414550 Original CRISPR TGCAGGAGGAACTGAGGCTG AGG (reversed) Intergenic
900345391 1:2208088-2208110 TGCAGGGGAAACTGAGGCGTGGG + Intronic
900396994 1:2457134-2457156 TGCAGGATGGCCTGGGGCTGGGG + Intronic
900600758 1:3501762-3501784 GGGAGGCGGAACTGGGGCTGCGG + Intronic
901204719 1:7487609-7487631 TGCAGGTGAGGCTGAGGCTGAGG + Intronic
901225412 1:7610483-7610505 CAGAGGAGAAACTGAGGCTGGGG - Intronic
901647834 1:10726280-10726302 CGGAGGAGGAAATGAGGCTTGGG + Intronic
901736608 1:11316539-11316561 CGTAGGAGCACCTGAGGCTGGGG - Intergenic
902729467 1:18359753-18359775 TCCATCAGGAACTGATGCTGTGG - Intronic
903176700 1:21585834-21585856 GGCAGGAGAAACTGGAGCTGTGG + Intergenic
903263086 1:22141945-22141967 GGCAGGAGGAACTGGGGCCAGGG + Intronic
903265290 1:22154334-22154356 GGCACCGGGAACTGAGGCTGAGG + Intergenic
903275937 1:22221885-22221907 TGCAGGAGGAACTGAGACTACGG - Intergenic
904204095 1:28841366-28841388 TGCAGGTGGCAAGGAGGCTGGGG + Intronic
904440153 1:30524840-30524862 ACCAGGAGGAACAGTGGCTGGGG + Intergenic
904467838 1:30718641-30718663 TGGAGGCGGGACCGAGGCTGAGG - Intronic
905235451 1:36543102-36543124 TGGAGCATGAGCTGAGGCTGGGG + Intergenic
905400472 1:37699005-37699027 TACAGAAAGAACTGAGGCTCAGG + Intronic
905883894 1:41481453-41481475 TGCAGGGGAAACTGAGGCAGGGG + Intronic
905908323 1:41635088-41635110 TTCATCAAGAACTGAGGCTGTGG - Intronic
906492643 1:46280021-46280043 TAGAGGAGGAATTGAGGTTGGGG + Intronic
906690292 1:47788136-47788158 TCCAAGAGGAATTGAGGATGTGG + Intronic
907297497 1:53464721-53464743 GGCGGGAGGAACTGGGGCTGCGG - Exonic
907612999 1:55891497-55891519 TGGAGGAGGGACTGAGGAGGAGG - Intergenic
909142496 1:71886492-71886514 GGAAGGAGGAATTGAGGGTGAGG + Intronic
910427014 1:87128444-87128466 GGCAGGAGGAAGTGAGGAAGGGG - Intronic
910654468 1:89605788-89605810 TCCAAAAGGTACTGAGGCTGGGG - Intergenic
910674043 1:89799639-89799661 TGCAGTAGGAAATGGGGATGTGG - Intronic
911398143 1:97337860-97337882 GGCAAGAGGACCTGAAGCTGTGG + Intronic
911967686 1:104388009-104388031 AGGAAGAGGAACTTAGGCTGTGG - Intergenic
912522923 1:110258863-110258885 AGCAGGAGGAGGGGAGGCTGAGG - Intronic
914877708 1:151524729-151524751 TAGAGGAGCAGCTGAGGCTGCGG + Exonic
915168304 1:153960738-153960760 TGCAGTGGGAACTGGAGCTGTGG + Exonic
915444780 1:155968430-155968452 TTCAGGAGGAATTGAGGGAGAGG + Intronic
915722036 1:157993018-157993040 TGGAGGAGGAACATGGGCTGAGG - Intergenic
916282661 1:163069421-163069443 GGCAGGAGGAGCTGTGGCTTCGG - Exonic
916559155 1:165918036-165918058 GGCAGGAGAAACTCAGGCTTTGG + Intergenic
917565333 1:176207053-176207075 CTCAGGATGCACTGAGGCTGAGG - Exonic
917817818 1:178727739-178727761 TGCAGAATGAACTGAGTCTCTGG - Intronic
917955547 1:180093556-180093578 TGCAGTAGGAACTGAAGCCAAGG - Exonic
917959503 1:180131092-180131114 TGCAGGTGCAACTGAGGTTAAGG + Intergenic
918141162 1:181721104-181721126 TGCAGGAGACACTGAGTCTGAGG + Intronic
919288764 1:195601196-195601218 TGTAGGAGGCACTCAGGCAGAGG - Intergenic
919557829 1:199082995-199083017 AGCAGTTGGAGCTGAGGCTGTGG - Intergenic
919817240 1:201449161-201449183 TGGAGCAGGATCTGAAGCTGAGG + Intergenic
920847779 1:209608003-209608025 TGGAGGAGGAGCTGAGACAGGGG - Intronic
920950438 1:210567196-210567218 TGGAGGAGAAACTGAGACTTGGG - Intronic
921796433 1:219350216-219350238 TGCATGTGGATCTCAGGCTGTGG - Intergenic
921822586 1:219634555-219634577 TGAAGGGGGAAATGAGGCTGAGG + Intergenic
922536259 1:226383058-226383080 AGCAGCAGGAGCCGAGGCTGTGG + Exonic
922831380 1:228556254-228556276 TGCAGGGGGAAGGGAGGCAGCGG - Intergenic
922966410 1:229694544-229694566 TGCAGCAGGAAGCGGGGCTGGGG + Intergenic
923284413 1:232478397-232478419 AGCTGGAGGATCTGAGGCTAAGG + Intronic
923468630 1:234270242-234270264 TGTGGGAGGAATTGAGGCAGGGG - Intronic
924449224 1:244162664-244162686 ATAAGGAGGAACTGAGGCTGAGG - Intergenic
924556281 1:245121738-245121760 TGCTGGAGGCACTGGGACTGCGG - Intronic
1062863531 10:829443-829465 TACAGGGGGAACTGCTGCTGGGG + Exonic
1062989498 10:1802801-1802823 GGAAGGAGGGACTGGGGCTGTGG + Intergenic
1063102432 10:2962455-2962477 TCCAGAAGGAACTGACCCTGAGG - Intergenic
1063473381 10:6307133-6307155 AGCAGGAAGAGCTGATGCTGTGG - Intergenic
1063527758 10:6801088-6801110 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
1064580056 10:16784910-16784932 GGCAGGAGGAAGTGGGGCTTTGG + Intronic
1064634288 10:17347838-17347860 GGCAGGAGAATCGGAGGCTGAGG + Intronic
1064905313 10:20339565-20339587 TGCAAGGGGCAGTGAGGCTGGGG - Intergenic
1066028029 10:31384728-31384750 TGCAGGTGGAAATGAGGCAAGGG + Intronic
1066616499 10:37300320-37300342 TGCAGAAGCAGCTGAGGCTCTGG + Intronic
1067539194 10:47139449-47139471 AGCAGGAGGAAATGAGGCCTGGG + Intergenic
1068280081 10:54856286-54856308 GGCAGGAGGAACTGGGGCAGAGG + Intronic
1068605409 10:58999892-58999914 TGGAGTAAGAACTGAGCCTGTGG + Intergenic
1068930229 10:62581881-62581903 TTCCAGAGGCACTGAGGCTGGGG - Intronic
1069477462 10:68747464-68747486 TGCAGCAGTGACTGGGGCTGGGG - Exonic
1069753509 10:70760028-70760050 TGCATCAGAAACTCAGGCTGGGG - Intronic
1069784362 10:70978416-70978438 AGGAGGGGAAACTGAGGCTGGGG - Intergenic
1069924731 10:71840838-71840860 TGCAGTAATGACTGAGGCTGGGG + Intronic
1070341265 10:75500389-75500411 TACAGAAGAAACTGAGGCTGAGG + Intronic
1070553582 10:77511152-77511174 TGAATCAGAAACTGAGGCTGGGG - Intronic
1070554438 10:77516941-77516963 TGAGGGAGGAAGTGAGGGTGAGG + Intronic
1071375867 10:85002525-85002547 GGCAGGAGGAACAGAGGATGAGG + Intergenic
1071749638 10:88460107-88460129 TACAGGAGAAACTAAGGCTCAGG + Intronic
1071993199 10:91120863-91120885 AGCAGTAGGAACTGAGGCCTAGG + Intergenic
1072580186 10:96733938-96733960 GGGTGGAGGAACGGAGGCTGAGG - Intergenic
1072626663 10:97116588-97116610 TTCAGGAGGCAGTGGGGCTGGGG + Intronic
1072742410 10:97917450-97917472 TGCTGGAGGGGCTGGGGCTGGGG - Intronic
1072813535 10:98482579-98482601 TGCAGCAGGAGCTGAGGGAGGGG - Intronic
1072905299 10:99447554-99447576 TGCAGTGGGAACTGAAGCTATGG + Intergenic
1072933694 10:99691490-99691512 TGCAGGAAGGACAGAGGTTGAGG - Exonic
1073625726 10:105094947-105094969 TGCAGCATGAACTGTGGCTCAGG - Intronic
1073709562 10:106021627-106021649 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1074056210 10:109924458-109924480 AACAGGAGGAAATGTGGCTGGGG - Intergenic
1074415369 10:113262722-113262744 GGGAAGAGAAACTGAGGCTGGGG + Intergenic
1074531317 10:114300692-114300714 TGCAGGAGAGAGTGAGTCTGGGG + Intronic
1074843105 10:117374790-117374812 TGCTGGAGGGGCTGAGCCTGCGG - Exonic
1074877831 10:117627989-117628011 AGCACGAGGGACTGAGTCTGAGG - Intergenic
1075028348 10:119003657-119003679 TGCAGGCTGCCCTGAGGCTGAGG - Intergenic
1075194511 10:120343948-120343970 TGTAGCAGGAAATGAAGCTGAGG + Intergenic
1075214613 10:120521076-120521098 TACAGGAGGAATGGATGCTGGGG - Exonic
1075554650 10:123421623-123421645 TACAGGAGTGGCTGAGGCTGGGG - Intergenic
1075589250 10:123679591-123679613 TGCTGGAGGAACTGAGGACTGGG + Intronic
1075932887 10:126314184-126314206 TGCTGGAGGAGCTGAGGGTGGGG + Intronic
1076152900 10:128177889-128177911 TGCAGCAGAAACGCAGGCTGTGG - Intergenic
1076157707 10:128216238-128216260 TAAAGGAGAAACTGAGGCTCAGG - Intergenic
1076330069 10:129657626-129657648 TGGAGGAGGAGCTGGAGCTGGGG + Intronic
1076342918 10:129761869-129761891 TGCAGCAGGACCTGTGGCTACGG + Intronic
1076483857 10:130803060-130803082 TGCAGGAGAAAGCCAGGCTGTGG + Intergenic
1077113589 11:872894-872916 TCCAGGAGGAGGTGAGGCTGGGG + Intronic
1077184164 11:1228947-1228969 TGCAGGAGAAGGAGAGGCTGTGG + Intronic
1077612105 11:3649616-3649638 GGGTGGAGGAGCTGAGGCTGAGG - Intronic
1077674136 11:4182326-4182348 TGCTGGAGGGACTGTGCCTGAGG + Intergenic
1077727373 11:4688226-4688248 TTCAGGAGGAATTGAGGGAGAGG + Intronic
1077766465 11:5164315-5164337 GGGTGGAGGAGCTGAGGCTGAGG + Intronic
1077848068 11:6046627-6046649 GCCAGGAGGAAAGGAGGCTGAGG + Intergenic
1077899712 11:6478654-6478676 TGCAGGAGGGAGGGAGGATGAGG + Intronic
1077929871 11:6720033-6720055 TGCATGATGAAGTGAGCCTGAGG + Intergenic
1078053480 11:7987417-7987439 TGGCGCTGGAACTGAGGCTGGGG - Exonic
1078449323 11:11428497-11428519 AGCAGGAGGCAATGTGGCTGTGG - Intronic
1078452135 11:11448554-11448576 TAATGGAGAAACTGAGGCTGAGG + Intronic
1079080613 11:17411129-17411151 TGCAGGAGGAACTGGTGCTTAGG - Intronic
1079638999 11:22780700-22780722 AGCTGGAGTAACTGAGTCTGTGG - Intronic
1079727150 11:23891186-23891208 GGGTGGAGGAGCTGAGGCTGAGG + Intergenic
1080388689 11:31825335-31825357 TGCAAGAGAATCTGAGGCTGGGG + Intronic
1080645090 11:34182383-34182405 TGCTGGAGGAGATGAGGCTGGGG - Intronic
1081564411 11:44248691-44248713 TGGAGGTGGAAAAGAGGCTGTGG - Intergenic
1081683586 11:45025970-45025992 GGCTGGAGGAGCTGATGCTGTGG + Intergenic
1082767555 11:57181346-57181368 TCCAGCAGCCACTGAGGCTGAGG + Intergenic
1082772490 11:57219247-57219269 TGCAGAAGTAACTGAAGCTCAGG - Intergenic
1084041262 11:66543995-66544017 TGCTGGGGGAACTGACGCTGTGG - Intronic
1084096131 11:66912811-66912833 CCCAGGGTGAACTGAGGCTGGGG - Intronic
1084147300 11:67271926-67271948 TGCAGCAGGGCCTGTGGCTGTGG - Intronic
1084189709 11:67493395-67493417 TGCAGGAGGTGCGGCGGCTGGGG - Exonic
1084654302 11:70506239-70506261 TGCAGGAGCAGCTCTGGCTGGGG - Intronic
1084698924 11:70773133-70773155 TGTAGGAGGAGCTGGGGGTGAGG + Intronic
1085391425 11:76184281-76184303 TGCAGGGAGCACAGAGGCTGTGG + Intergenic
1086334978 11:85791489-85791511 TGGATGAGATACTGAGGCTGAGG - Intronic
1088463192 11:110104460-110104482 TGCAGGAGAGACTTACGCTGTGG + Intronic
1089287863 11:117419388-117419410 TCCAAGAGGAAATGGGGCTGAGG - Intergenic
1089456939 11:118631260-118631282 TGATGGGGGACCTGAGGCTGGGG + Exonic
1089637837 11:119827689-119827711 GGAAGGATGAACTGAGGCTAAGG - Intergenic
1090027281 11:123178744-123178766 AGCAGGAGGATGTGTGGCTGTGG + Intronic
1090648878 11:128789220-128789242 TGCAGGAATAACTGAGGCCTGGG + Intronic
1090872864 11:130763329-130763351 GGCAGGAGGACTTGAGGCGGAGG + Intergenic
1091224359 11:133948803-133948825 GGCAGGAGGAACAGAGGCCTAGG + Intronic
1091449314 12:562615-562637 GGCAGGAGGAACTGAAGAGGGGG + Exonic
1091816970 12:3446076-3446098 TGCCCAAGGAACTGAGGGTGGGG - Intronic
1092100265 12:5877598-5877620 AGCAGGGGAAACTGAGGCAGAGG - Intronic
1092880553 12:12884793-12884815 TGGAGGAGGAAGTGAGGATGAGG + Intergenic
1093233788 12:16581335-16581357 AGAAGAAGGCACTGAGGCTGAGG - Intronic
1094279786 12:28723478-28723500 TGGAGAAGAAACTGATGCTGAGG + Intergenic
1095220838 12:39612788-39612810 TGCAGCAGAAACTGAAGCTATGG + Intronic
1095948108 12:47765386-47765408 AGCAGGAGGGGCTGAGGCTGAGG - Intronic
1096180185 12:49546424-49546446 TGCAGGGGGAGGTGAGGCTGAGG + Intronic
1096513689 12:52145276-52145298 AGCAGGAGGACTTCAGGCTGAGG + Intergenic
1096673515 12:53214191-53214213 TGCAGCTGGATCTGGGGCTGTGG - Exonic
1097235860 12:57539191-57539213 TGCAGGAGGAAATGAGAACGGGG - Intronic
1097688903 12:62715654-62715676 TGCAGGAGGAAGTGTGGGAGAGG - Intronic
1098403262 12:70096356-70096378 TGCAGGAGAAACTTAGGTGGGGG - Intergenic
1099313948 12:81061957-81061979 TCAAGGAGGCAGTGAGGCTGGGG - Intronic
1099589610 12:84570567-84570589 TTCAGGAGAAACTGGGGCTTTGG + Intergenic
1099977641 12:89562861-89562883 GGCAGGAGGAAATGAAGCTAAGG - Intergenic
1100318536 12:93467678-93467700 TGCAGGAAGGACAAAGGCTGGGG - Intronic
1101232097 12:102752039-102752061 TCCAGGTGGTACTGATGCTGCGG + Intergenic
1101424286 12:104575385-104575407 TGCAGGAGGAACTGGGGACAGGG + Intronic
1101724585 12:107378469-107378491 TACATGAGGATCTGAGGCTCTGG + Intronic
1101970398 12:109308951-109308973 TGGGGGCGGAACTGAGGCTTTGG - Intronic
1102441462 12:112967068-112967090 TGCAGGAGGATGTAAGACTGAGG + Intronic
1103287463 12:119814535-119814557 GGCAGGAGGAAGTGAGGAAGAGG - Intronic
1103325061 12:120115107-120115129 TGGAAGAGTAACTGAGGTTGGGG - Intronic
1103566767 12:121819993-121820015 TACACGGGAAACTGAGGCTGGGG - Intronic
1104910269 12:132236913-132236935 TGCGGGAGGAAGCCAGGCTGTGG - Intronic
1104972122 12:132535612-132535634 TGCATGGGGAAGTGAGGCTGAGG + Intronic
1105072725 12:133245354-133245376 TGCAAGGGGCAGTGAGGCTGGGG + Intergenic
1105984613 13:25553198-25553220 TCCAGGAGGAACAGAGAATGGGG - Intronic
1106637541 13:31545011-31545033 TGTAGGGGGGACTGAGGCAGTGG + Intergenic
1107018059 13:35724296-35724318 TGGAGGATGAGCTGAGGGTGGGG - Intergenic
1107175640 13:37395182-37395204 TGGAGAAGGAACAGAGCCTGAGG + Intergenic
1108494010 13:51006659-51006681 TGCTGGAGCCTCTGAGGCTGTGG + Intergenic
1108639766 13:52372119-52372141 TGGAAGTGGGACTGAGGCTGGGG - Intergenic
1108803955 13:54131714-54131736 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1109271130 13:60256318-60256340 AGCAGGAGGAATTGGGGGTGGGG + Intergenic
1109499221 13:63214837-63214859 GGGTGGAGGAGCTGAGGCTGAGG - Intergenic
1111179997 13:84651745-84651767 TAAAGGAATAACTGAGGCTGGGG - Intergenic
1111243395 13:85504777-85504799 AGCAGGAGGAAGTGAGGAGGGGG + Intergenic
1113205076 13:107907646-107907668 GGCAGGAGCAAGTGAGACTGGGG - Intergenic
1113358243 13:109603561-109603583 TTCAGCAGGAAGTGTGGCTGAGG - Intergenic
1113849324 13:113409040-113409062 TAGAGGAGCCACTGAGGCTGGGG + Intergenic
1113892336 13:113743073-113743095 GGCAGGAGGAATTGGGGGTGTGG - Intergenic
1114456194 14:22855180-22855202 TGCTTGAGGTACAGAGGCTGAGG - Intergenic
1114579843 14:23747480-23747502 AGAAAGAGGAACTAAGGCTGAGG + Intergenic
1115415049 14:33122780-33122802 AGCAGGAGAAACAGAGACTGAGG + Intronic
1115819831 14:37202059-37202081 GGCAGGAGGACCTGAGGCCAGGG - Intronic
1116003468 14:39267719-39267741 TGGAGGAGGACCTGGGGCTCTGG + Intronic
1117404324 14:55387202-55387224 TGGAGGAGGCCTTGAGGCTGAGG - Intronic
1118288956 14:64503607-64503629 GGCAGGAGGGACTGAGCCCGGGG + Intronic
1118436990 14:65780503-65780525 TGCAGGAGCCACTGGTGCTGAGG - Intergenic
1118466240 14:66033867-66033889 TGCAGGAGGTCCTGAGGCCGAGG - Intergenic
1119253335 14:73176768-73176790 TGGATGAGGCACTGAGGCAGGGG + Intronic
1119574960 14:75711769-75711791 TGAAGAAGGAACTGGGGGTGGGG - Intronic
1119856501 14:77904951-77904973 GGCAGGAGGACCTGGGGGTGTGG - Intronic
1121108669 14:91297162-91297184 TGGAGGTGGCACAGAGGCTGCGG - Intronic
1121324417 14:93011679-93011701 TGCAGGGGCACCTGGGGCTGAGG + Intronic
1121324976 14:93014555-93014577 GGAGGAAGGAACTGAGGCTGTGG + Intronic
1121416186 14:93780657-93780679 TGCAGGTGGAGCTGGGCCTGGGG + Intronic
1122234349 14:100323491-100323513 AGCAGGAGGAACTGAGGTCCAGG + Intronic
1122508497 14:102247533-102247555 AGGAGGTGGAACTGAGACTGCGG + Intronic
1122744847 14:103891549-103891571 TGTGGCAGGAGCTGAGGCTGGGG - Intergenic
1122828711 14:104384940-104384962 TGCTGGAGGAAATCAGGCCGAGG - Intergenic
1123110041 14:105862971-105862993 TGATGGAGTAACTGAGCCTGGGG - Intergenic
1123129801 14:105975787-105975809 TGCAGGAGGCTCTGAAGCAGTGG - Intergenic
1123468668 15:20534289-20534311 GGGAGCAGGAAGTGAGGCTGCGG - Exonic
1123649446 15:22466773-22466795 GGGAGCAGGAAGTGAGGCTGCGG + Exonic
1123728987 15:23129500-23129522 GGGAGCAGGAAGTGAGGCTGCGG - Exonic
1123747151 15:23326965-23326987 GGGAGCAGGAAGTGAGGCTGCGG - Intergenic
1124018859 15:25902109-25902131 TGCAGGCTCATCTGAGGCTGGGG - Intergenic
1124183055 15:27496296-27496318 GGCAGGAGTGAGTGAGGCTGAGG + Intronic
1124279419 15:28350281-28350303 GGGAGCAGGAAGTGAGGCTGCGG - Intergenic
1124303279 15:28561327-28561349 GGGAGCAGGAAGTGAGGCTGCGG + Intergenic
1124532178 15:30517767-30517789 GGGAGCAGGAAGTGAGGCTGTGG + Intergenic
1124591650 15:31059122-31059144 TCCAGGAGGAACAGGGGCAGTGG + Intronic
1124766475 15:32489878-32489900 GGGAGCAGGAAGTGAGGCTGTGG - Intergenic
1124825492 15:33090554-33090576 TGCAGGGGGAACATAGACTGGGG - Intronic
1124999072 15:34753044-34753066 TCCTGGAGGAACTGGGGGTGGGG - Exonic
1125419725 15:39492622-39492644 TGGAGAAGGAACTGAGGGCGAGG + Intergenic
1125500601 15:40238509-40238531 TGGAGGAGACACTGAGGCTAGGG + Intergenic
1125697335 15:41650395-41650417 GGTAGGAGGAACTGACACTGAGG - Intronic
1125728383 15:41879733-41879755 AGCAGGAGGAACTGAGCCAGAGG - Exonic
1125880093 15:43185904-43185926 CGCTGGAGGAACTGAGGCAAGGG - Intronic
1127269893 15:57390946-57390968 TACAGGTGGGACTTAGGCTGAGG - Intronic
1127454179 15:59142696-59142718 TGCAGCAGGGAGTAAGGCTGGGG - Intronic
1127551587 15:60043970-60043992 AGATGGAGGAACTGAGGCTCGGG + Intronic
1127825881 15:62702320-62702342 TGCAGGAGTAACTGGAGTTGTGG + Intronic
1128113816 15:65093296-65093318 TGCAGTAGGCACTGGAGCTGGGG - Intronic
1128348726 15:66874593-66874615 TGCTGGAGGCTCTGAGTCTGGGG + Intergenic
1128378644 15:67094975-67094997 TGCTGGAGAAACTGAGGCTCAGG - Intronic
1128579505 15:68798963-68798985 TGCAGAAGAACCTAAGGCTGGGG + Intronic
1128809027 15:70556506-70556528 GGCATGAGGTGCTGAGGCTGGGG + Intergenic
1129265638 15:74391836-74391858 CTCAGGAGCCACTGAGGCTGTGG + Intergenic
1129604487 15:77018227-77018249 TGGAGGAGCTACTGAGGCAGAGG + Exonic
1129615544 15:77096677-77096699 TGCGGTTGGCACTGAGGCTGGGG + Intergenic
1129675577 15:77631291-77631313 TGCAGGAGGCCCTGAGGTAGGGG - Intronic
1129844657 15:78762687-78762709 TCCAGGAGGCACTGAGGGGGCGG - Intronic
1129860964 15:78861007-78861029 GGCAGGAGAATCGGAGGCTGTGG + Intronic
1130233662 15:82114901-82114923 GGCAGGTGGAGCTGAGGGTGAGG - Intergenic
1131019891 15:89088801-89088823 TGCCCGAGGAACCGAGGTTGGGG + Intronic
1131054095 15:89365450-89365472 TGGAGGAGGCACTGATTCTGGGG + Intergenic
1131087026 15:89585386-89585408 TAAAGGAGGGATTGAGGCTGAGG - Intronic
1132262935 15:100441971-100441993 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132340330 15:101074251-101074273 TGGTGGAGGAGCGGAGGCTGAGG - Intronic
1132665805 16:1080844-1080866 TGCAGGAGGACCTGAGGGTCAGG + Intergenic
1132694811 16:1197213-1197235 TCCAGGAGAAACTGAGGTTCAGG - Intronic
1132831878 16:1932446-1932468 TGCAGGAGGAGCAGTGGCTCTGG - Intergenic
1132936373 16:2483330-2483352 TGCACGAGGAAGTGAGCCCGAGG - Intronic
1132989822 16:2786912-2786934 TGGAGGAGGGAGTGAGGATGAGG - Intronic
1133193905 16:4154739-4154761 AGCAGCAGGAACCAAGGCTGAGG + Intergenic
1134070535 16:11256943-11256965 TGCGGAAGAAACTGAGGCTGGGG + Intronic
1134209637 16:12265328-12265350 AGCAGGTGGGACTGTGGCTGGGG + Intronic
1134217391 16:12326782-12326804 TGCAGGTGGCACTGAGGCTGGGG + Intronic
1135080022 16:19426316-19426338 GGCAGGAGGCAATGAAGCTGGGG - Intronic
1135107050 16:19658935-19658957 AGCTGGAGAAACTGAGGCTCAGG + Intronic
1135117910 16:19739140-19739162 TGCAGGTGGAACTGGGGGTGGGG + Intronic
1136172479 16:28497204-28497226 TGCCAGAGAAACTGAGGATGAGG + Exonic
1136253486 16:29023124-29023146 TGCTGAAGAAACTGAGGCAGAGG - Intergenic
1136354076 16:29732290-29732312 TTCAGGAGAAACTGAGCTTGTGG - Intergenic
1136548080 16:30966424-30966446 TGCAGGAGGAAATGGGCCTCTGG + Intronic
1137001292 16:35233144-35233166 AGGAGGAAAAACTGAGGCTGGGG - Intergenic
1137021884 16:35436252-35436274 TCCAGGAGGCTCTGTGGCTGTGG - Intergenic
1137712270 16:50574618-50574640 GGCAGGAGGAGCTGTGCCTGGGG + Intronic
1138418059 16:56882540-56882562 GGCAGGAGGAACTGGGGCATGGG + Intronic
1138451876 16:57098056-57098078 TGCAGGATGAGCTGAACCTGGGG + Intronic
1138516479 16:57538026-57538048 TGGAGGTGGAAATGGGGCTGGGG + Intergenic
1138616588 16:58172440-58172462 TGTAGAAGCAACTGAGGCTGAGG - Intronic
1138770712 16:59660368-59660390 TGAAGGAGGAAGTAAGGATGGGG + Intergenic
1138836115 16:60436898-60436920 TGGAGGAGGAAATGAAGATGAGG + Intergenic
1138868858 16:60856123-60856145 TTAAGGAGTAATTGAGGCTGAGG + Intergenic
1139507813 16:67408029-67408051 TGCAGGAGGCTCTGAGCCTCAGG - Intronic
1139527343 16:67525082-67525104 GGAAGGAGCAGCTGAGGCTGGGG - Intronic
1141096270 16:81165271-81165293 GGCAGGAGGAACTGAGGCTTGGG + Intergenic
1141380117 16:83568768-83568790 TGGAGGAGGAACTGGGACTGAGG - Intronic
1141413341 16:83851492-83851514 TGCTGAAGGAGCTGTGGCTGAGG - Intergenic
1141461821 16:84182320-84182342 TGCACGAGGAGCTGGTGCTGCGG - Exonic
1141483024 16:84319407-84319429 TGCAGGAGGGACACACGCTGGGG - Intronic
1141908241 16:87041607-87041629 TGGAGGAGGAACCAGGGCTGGGG - Intergenic
1141921901 16:87141044-87141066 GGCAGCAGGAAGTGAGGCTGAGG - Intronic
1142067827 16:88072843-88072865 AGCAGGTGGCACGGAGGCTGCGG - Intronic
1142125366 16:88407590-88407612 TGCAGGGGAAACTGAGGCATGGG + Intergenic
1142219075 16:88844190-88844212 GGCAGGAAGCACGGAGGCTGGGG + Intronic
1142341493 16:89525869-89525891 TGCAGGTGTAGCTGAGTCTGAGG + Intronic
1142350665 16:89577837-89577859 TTCAGGAGGAGCTGAGGAGGGGG - Intronic
1142753763 17:2003463-2003485 TGCAGGAGGAACAGCAGCAGCGG + Intronic
1142850419 17:2701890-2701912 TGCGGGAGGCACTGGGGCCGGGG - Intronic
1142873228 17:2834826-2834848 TGGGGTAGGAACTGAGGCAGAGG - Intronic
1143492000 17:7290145-7290167 AGAAGGAGGAACTGAGGGTTGGG - Intronic
1143756522 17:9071862-9071884 TGCAGTATGAATGGAGGCTGGGG + Intronic
1143788139 17:9272099-9272121 GTCAAGAGGAAATGAGGCTGAGG - Intronic
1143838908 17:9714986-9715008 AGCAGGTGGACCAGAGGCTGGGG + Intronic
1144579948 17:16452897-16452919 TGAAGGAGGAGCTGCAGCTGAGG - Intronic
1144707621 17:17380047-17380069 TACTGGAGAAACTGAGGCTGAGG - Intergenic
1146380399 17:32323333-32323355 AGGAGGAGGCTCTGAGGCTGTGG + Exonic
1146448401 17:32951883-32951905 GGCAGGAGCAGGTGAGGCTGGGG - Intergenic
1146523570 17:33546825-33546847 TGCAGGAGGAGCTGGGAGTGAGG - Intronic
1146679698 17:34798113-34798135 TCCCTGAGGAAGTGAGGCTGAGG - Intergenic
1146787592 17:35732598-35732620 TGCAGGAGGCCCCTAGGCTGGGG - Intronic
1148896701 17:50843089-50843111 AGCAGGAAGAACAGAGGCAGAGG + Intergenic
1149622865 17:58059458-58059480 ACCAGGAAGAACTGTGGCTGTGG + Intergenic
1150281510 17:63931889-63931911 CTCAGGAGGAAGAGAGGCTGAGG - Intronic
1151355101 17:73553626-73553648 TGCAGGTGGGATGGAGGCTGTGG - Intronic
1151680958 17:75622476-75622498 TGCAGGGAGAACGGAGGATGAGG + Intergenic
1151757467 17:76082973-76082995 GCCAAGAGGCACTGAGGCTGGGG + Exonic
1152092103 17:78252743-78252765 TGCAGGAGGCTCTGAGGAGGGGG - Intergenic
1152369630 17:79878309-79878331 TACAGGAGGCCCTGGGGCTGGGG - Intergenic
1152629032 17:81401550-81401572 TGCACGGGGCGCTGAGGCTGGGG + Intronic
1153675612 18:7453688-7453710 TCCAGTAGGAACTTAGGCTCAGG - Intergenic
1153771396 18:8419630-8419652 AGCAGGAGGAAGAGAGGTTGGGG + Intergenic
1154311270 18:13268239-13268261 TAAAGGAGGAACTGAGACTAAGG - Intronic
1154379130 18:13833750-13833772 AGCTGGAGGCACTGTGGCTGAGG + Intergenic
1156367893 18:36446597-36446619 TGCGGGAGGAGCTGCAGCTGGGG + Intronic
1157235739 18:45963672-45963694 TGGTGGTAGAACTGAGGCTGAGG + Intronic
1157376292 18:47169073-47169095 TGCTGGAGGGCCTGAGGTTGTGG - Intronic
1157512727 18:48290294-48290316 AGGAGGTGGGACTGAGGCTGGGG - Intronic
1160016494 18:75145174-75145196 TGTAGGAGGAACCCAGGGTGGGG - Intergenic
1160251084 18:77204014-77204036 TGTCTGAGGAACTCAGGCTGAGG + Intergenic
1160335968 18:78039956-78039978 TGCAGGAGGCACTGAGCCGCTGG - Intergenic
1160374507 18:78401275-78401297 GGCAGGAGGAAGAGAGGATGTGG + Intergenic
1160865924 19:1255901-1255923 GGCAGGAGGAAGTGGGCCTGTGG - Intronic
1160895771 19:1401239-1401261 CGCAGGGGAAACTGAGGCCGGGG - Intronic
1160904768 19:1446905-1446927 TGGAGGGGAAACTGAGGCTGGGG + Intronic
1160918020 19:1506918-1506940 TGCAGGAGGACCTGGAGCAGGGG + Exonic
1160966189 19:1747959-1747981 AGCGGGAGGGACAGAGGCTGTGG + Intergenic
1161238035 19:3207596-3207618 AGCAGGAGGGAGTGAGGATGTGG - Intronic
1161252148 19:3285986-3286008 TGCAGGAGGGGCGGCGGCTGGGG - Exonic
1161317365 19:3623889-3623911 TGCAGGAGCGGCTGCGGCTGCGG - Exonic
1161398223 19:4055969-4055991 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161398249 19:4056121-4056143 AGCTGGGGAAACTGAGGCTGGGG - Intronic
1161777385 19:6270989-6271011 TGCGGGTGGAATTGAGGATGAGG - Intronic
1161939890 19:7395559-7395581 TGAACGAGGAGCAGAGGCTGGGG - Intronic
1162016625 19:7849808-7849830 TGATGGAAGACCTGAGGCTGAGG - Intronic
1162049958 19:8027055-8027077 AGAGGAAGGAACTGAGGCTGGGG + Intronic
1162535906 19:11262614-11262636 GGCTGGGGAAACTGAGGCTGGGG + Intergenic
1162535942 19:11262719-11262741 GGCTGGGGAAACTGAGGCTGAGG + Intergenic
1162535975 19:11262834-11262856 GGCTGGAGAAACTGAGCCTGAGG + Intergenic
1163255329 19:16152736-16152758 AGCAGCAGTAACTGAGGCTGTGG + Intronic
1163266413 19:16225054-16225076 AGCACGAGGAGGTGAGGCTGGGG + Intronic
1163524137 19:17810135-17810157 TGTAGGGGAAACTGAGGCTGAGG + Intronic
1163691104 19:18738969-18738991 GGCTGGAGGGAGTGAGGCTGGGG + Intronic
1163691496 19:18741089-18741111 TGCTGGAGGCACTCAGGCTTCGG - Intronic
1163991328 19:21001736-21001758 ACCAGGAAGAACTGGGGCTGGGG - Intergenic
1165230198 19:34381939-34381961 TGCAGGAGGAGCTGGGGGGGTGG + Intronic
1165325436 19:35111792-35111814 TGCAGGAGGAGCTGAGGTGGGGG - Intergenic
1165354319 19:35294155-35294177 TGCAGGAGATACTGAAGCGGGGG + Intronic
1165559654 19:36668023-36668045 TGCGGGAGGAGCTGAGGAGGTGG - Intergenic
1165642675 19:37403368-37403390 AGCTGGAAGAACTAAGGCTGAGG - Intergenic
1165848954 19:38837988-38838010 GTCAGGGGGAACTGAGGCAGCGG - Intronic
1166690846 19:44820631-44820653 AGGGGGAGGAACTGAGGATGGGG - Intronic
1166706240 19:44909426-44909448 AGAAAGAGAAACTGAGGCTGGGG - Intergenic
1166751410 19:45165478-45165500 TGGAGGAGGAAGGGAGCCTGGGG - Intronic
1166830896 19:45639181-45639203 TGCTGGGGGAACTGCGGGTGGGG - Intronic
1167043371 19:47036022-47036044 TGCTGGAGCAACTGGGGCTGCGG + Exonic
1167520453 19:49951612-49951634 TGCAGGAGGAAATGAGGAGTGGG + Intronic
1167618563 19:50549123-50549145 AGCAGGGAAAACTGAGGCTGGGG + Intronic
1167668609 19:50837015-50837037 TCCAGAAGGAACGGAGGCCGTGG - Intronic
1168241582 19:55091644-55091666 TGGAGGAGGAGCTGAAGGTGGGG - Exonic
1168485461 19:56758731-56758753 TGCAGAAGGAATTGATTCTGAGG + Intergenic
925090483 2:1151227-1151249 TGCAGGCTGAAATCAGGCTGCGG + Intronic
925121552 2:1422208-1422230 AGCAGGAAGAAATGATGCTGGGG + Intronic
925561883 2:5204852-5204874 TGAAGGAGGAAGTGAGGGTCTGG + Intergenic
926766879 2:16329956-16329978 TGCAGGAGGAGGTATGGCTGTGG - Intergenic
926804658 2:16696072-16696094 TGCAGGAGGGACTCAGGGGGAGG + Intergenic
926861607 2:17315961-17315983 TTCTGGAGGCACTGAGGGTGGGG + Intergenic
926933477 2:18063585-18063607 TGAAGGAGGAGCTCCGGCTGAGG + Intronic
926999434 2:18777428-18777450 AGCAGGAGGAGGAGAGGCTGGGG + Intergenic
927174531 2:20396272-20396294 GGCAGGAGGGACAGAGCCTGTGG + Intergenic
928106192 2:28471982-28472004 TGCTGGAGGAGCTGGGGCAGCGG - Intronic
928158044 2:28894609-28894631 TGGAGGAGGAAGTGAGGCGGAGG - Intergenic
928605884 2:32945221-32945243 TGAAGGAGGCACTGAGGCTGTGG - Intergenic
928762869 2:34605226-34605248 GGCAGGAGGAGATGGGGCTGAGG + Intergenic
928879336 2:36079874-36079896 TGCAGGAGGAACTGAGCAGGGGG - Intergenic
928922628 2:36541429-36541451 TACAGAAGAAACTGAGGCTCAGG + Intronic
929501560 2:42494565-42494587 GGCAGGCGGCACCGAGGCTGGGG - Exonic
929741975 2:44611833-44611855 AGCAGGAGCAAATGAGGTTGGGG + Intronic
930048836 2:47197958-47197980 TATAGGAGGAACTGAAGCTTAGG - Intergenic
931036637 2:58251516-58251538 TGGCGCTGGAACTGAGGCTGGGG - Intergenic
932490388 2:72116285-72116307 TGCAGGTGGCCCTGGGGCTGAGG - Intergenic
933595318 2:84277622-84277644 GGCAGGAGGAAGGGAGGCAGGGG + Intergenic
933707667 2:85304007-85304029 AGCAGGGGGAAGAGAGGCTGTGG - Intronic
933739228 2:85520163-85520185 TGCAGCAGGGCCTGAGGCTTGGG + Intergenic
934732730 2:96669663-96669685 GGCAGGAGGGAATGAGGCAGGGG - Intergenic
934990913 2:98920966-98920988 TCCAGGAAGACATGAGGCTGAGG + Intronic
935198819 2:100837931-100837953 AGAAGGGGAAACTGAGGCTGAGG + Intronic
935444380 2:103140638-103140660 TGCAGAAGGTAGAGAGGCTGAGG - Intergenic
935672038 2:105564209-105564231 AGCAGGAGGGACTGGGGCTTGGG + Intergenic
935685741 2:105681031-105681053 GGCAGGGGAAATTGAGGCTGGGG + Intergenic
936785003 2:116084387-116084409 TGAAGAAGAAACTGAGGCTTTGG + Intergenic
936794376 2:116188259-116188281 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
937224159 2:120358638-120358660 TGCTGGAGCAACTGAGGCTGAGG + Intergenic
937244927 2:120486532-120486554 GCCAGGAGGAAGTCAGGCTGAGG - Intergenic
937303235 2:120856132-120856154 AGCAGGGAGAACTCAGGCTGAGG - Intronic
937871091 2:126786893-126786915 AGAAGGGGAAACTGAGGCTGGGG + Intergenic
937907982 2:127061623-127061645 TCCCGGAGGGGCTGAGGCTGAGG + Intronic
938256585 2:129864078-129864100 TGCAGATGGACCAGAGGCTGAGG + Intergenic
938307102 2:130263804-130263826 TGTAGGAGGAAGGGAGGCGGGGG + Intergenic
938397504 2:130962313-130962335 TCCTGGAGGAACTGAGGAGGGGG + Intronic
938929920 2:136077676-136077698 TGCAGCAGGTGCTGTGGCTGTGG - Intergenic
939041502 2:137194236-137194258 TGCAGGAGTTGCTGAGGGTGGGG + Intronic
939501075 2:142985235-142985257 TGAAGGAGAAACTGGGTCTGTGG + Intronic
940001725 2:148973331-148973353 TGCAGGAGAAGCTGTGCCTGAGG + Exonic
941043435 2:160648328-160648350 TGCAGTGGGAAGTGAGGTTGAGG - Intergenic
941424258 2:165322327-165322349 TGCAGCAGGACTTGAGGCTCGGG - Intronic
942607383 2:177707193-177707215 TACAGGAGGAACTGAGCCTCAGG - Intronic
944420526 2:199525238-199525260 TGCTGGAGGGTCTGAGGCTAAGG + Intergenic
946037621 2:216756379-216756401 TGTAGGAGACATTGAGGCTGGGG + Intergenic
946195770 2:218032451-218032473 GGCAGCAGGAGCTCAGGCTGTGG + Intergenic
946201364 2:218072656-218072678 TGCAGGGGGACCTGAGGCCATGG - Intronic
947952737 2:234161950-234161972 AGCAGGAGGAGCACAGGCTGAGG - Intergenic
948197964 2:236109060-236109082 TGCATGAGGAACAGAGAATGGGG + Intronic
948757130 2:240166349-240166371 GGCTGGAGGAAGTGAGGGTGGGG + Intergenic
948808380 2:240462709-240462731 TGCAGGAGGGACTGAGGCTGTGG - Intronic
948862587 2:240760153-240760175 TGGAGGAGGAGCTGAGGTGGGGG - Intronic
1168887205 20:1267860-1267882 AGATGGAGAAACTGAGGCTGGGG - Intronic
1168966991 20:1904738-1904760 AGAAGGGGAAACTGAGGCTGAGG - Intronic
1169118913 20:3083814-3083836 AGCAGGAGGAAGAGAGGCTGCGG + Intronic
1170823039 20:19770621-19770643 TGGAAGAGGGACAGAGGCTGGGG - Intergenic
1171347591 20:24477790-24477812 TTCAGGGGAGACTGAGGCTGGGG + Intronic
1172579303 20:36034224-36034246 TGGAAGAGCAACTGAGGATGAGG + Intergenic
1172634431 20:36400646-36400668 TGATGGGGAAACTGAGGCTGGGG + Intronic
1173201765 20:40959959-40959981 TGCAGGAGGAGGGGAGGTTGGGG + Intergenic
1173380300 20:42533811-42533833 AGAAGTAGGGACTGAGGCTGAGG - Intronic
1173433577 20:43012849-43012871 TCCAGGTGGAACTGAGTCTGTGG + Intronic
1173916075 20:46709611-46709633 GGCAGGAGGGACAGAGGCGGGGG + Exonic
1174062579 20:47843222-47843244 GACTGGAGGAGCTGAGGCTGCGG - Intergenic
1174073056 20:47912276-47912298 GACTGGAGGAGCTGAGGCTGTGG + Intergenic
1174151008 20:48486365-48486387 GACCGGAGGAGCTGAGGCTGTGG - Intergenic
1174503374 20:51001563-51001585 GGGAGGAGGAACAGAAGCTGGGG - Intergenic
1174538761 20:51273309-51273331 AGCAGGAGGAAGTGGGGCTGTGG + Intergenic
1175102402 20:56588782-56588804 GGCAGGAGGATCTGAGTCAGAGG - Intergenic
1175225598 20:57442185-57442207 GGCAGGAGGAGCTGAGGAGGGGG - Intergenic
1175258593 20:57661555-57661577 AGGAGGAGGAACTGAGTCAGTGG - Intronic
1175296530 20:57912613-57912635 TGGAGGAGAAACTGAGGCCCAGG + Intergenic
1175823488 20:61924295-61924317 TGCAGGGGGAGGTAAGGCTGGGG - Intronic
1176024272 20:62977920-62977942 ATCAGGAGGGACCGAGGCTGTGG + Intergenic
1176027212 20:62992079-62992101 TGCAGGAGGAAGAGAGAGTGGGG - Intergenic
1176028252 20:62997392-62997414 AGAAGGAGAAACCGAGGCTGGGG - Intergenic
1176049855 20:63112975-63112997 AGATGGAGGGACTGAGGCTGAGG + Intergenic
1176976272 21:15326240-15326262 GTCTGGAGGAACTGAGGCTCTGG - Intergenic
1177361275 21:20075437-20075459 TGCAGTAGGAAGTGAGGATGAGG + Intergenic
1180076286 21:45464834-45464856 TGCAGCTGGGACTCAGGCTGTGG - Intronic
1180115423 21:45700537-45700559 TGCAGAAGGAACTGTCCCTGTGG - Intronic
1180834294 22:18922145-18922167 TTCAGGAGTCCCTGAGGCTGGGG - Intronic
1181052977 22:20246426-20246448 TGCAGGAGGGAGTGTGGCGGGGG + Intronic
1181406515 22:22688860-22688882 AGGAGGAGGCACTTAGGCTGGGG - Intergenic
1181564682 22:23728217-23728239 TGCAGCAGAAACAGATGCTGGGG - Intergenic
1182060161 22:27391566-27391588 TGGAGGTGGGACTGAGGCCGGGG + Intergenic
1182063664 22:27415726-27415748 TGCAGGAGGACCTGGGGCCCTGG + Intergenic
1182281262 22:29218951-29218973 TGCAGGAGGATCTGGGGCAGGGG - Intronic
1182622020 22:31623601-31623623 TGCAGGAGAGACTGAGGTGGTGG - Intronic
1182741137 22:32568258-32568280 TGGAGGAGGAACTGAGTTTTAGG - Intronic
1183209644 22:36442985-36443007 TGAAGCAGGAACTGAGGGTGGGG - Intergenic
1183742662 22:39677465-39677487 TGCAGGAGGAACTGGGGGGGCGG + Intronic
1183832409 22:40425342-40425364 TACAGAAGGAACTGAGGCAGTGG + Intronic
1184058953 22:42070496-42070518 TGAAGGAAGAACTGAAGCTCCGG - Exonic
1184321227 22:43743717-43743739 TGAAGGAGGGACTGGGGTTGGGG - Intronic
1184421869 22:44386842-44386864 TGCAGGAGCTACTGAGCCTGGGG - Intergenic
1184679177 22:46061341-46061363 TGCCGGGGAAACTGAGGCTCCGG - Intronic
1184695743 22:46138175-46138197 AGCAAGAGGCACTGGGGCTGAGG + Intergenic
1184954348 22:47873761-47873783 ATCAGGAGAAACTGACGCTGAGG - Intergenic
1184955141 22:47880991-47881013 TGCAGGAGGCACTAGGGGTGTGG + Intergenic
1185016140 22:48343899-48343921 TGCAGGAGGGACTGTCACTGGGG - Intergenic
1185292756 22:50035370-50035392 TGAAGGGAGAAGTGAGGCTGGGG + Intronic
1185419829 22:50729069-50729091 GGCAGTAGGGACAGAGGCTGAGG + Intergenic
1203284383 22_KI270734v1_random:147444-147466 TTCAGGAGTCCCTGAGGCTGGGG - Intergenic
949348816 3:3102934-3102956 CGCAGGAGCAACTGTGTCTGTGG - Intronic
949932147 3:9087589-9087611 GGCAGGAGGCACGGAGACTGGGG + Intronic
950499575 3:13355078-13355100 AGCTGGAGAAACTGAGGCTCAGG - Intronic
951316402 3:21193219-21193241 GGGTGGAGGAACAGAGGCTGAGG + Intergenic
952341113 3:32448519-32448541 TCCGAGAAGAACTGAGGCTGGGG - Intronic
952969686 3:38643142-38643164 AACATGAGGAACAGAGGCTGGGG + Intronic
953510841 3:43537344-43537366 TGCACAAGGAACTCAGGTTGAGG - Intronic
953565449 3:44028297-44028319 AGAAGGAGGGACTGAGGCTGTGG - Intergenic
953923648 3:46969146-46969168 TGCTGGAGGAACAGAGGCAGTGG - Intronic
954409599 3:50364685-50364707 TGGACGAGGACTTGAGGCTGCGG + Exonic
954525867 3:51270791-51270813 TGCAGAAGCAAATGAAGCTGTGG - Intronic
955143085 3:56289139-56289161 AGCAGGAGGAGCTAAGGTTGAGG - Intronic
955414711 3:58681320-58681342 TGCAAGAGGTCCTGACGCTGAGG + Intergenic
956452075 3:69385257-69385279 TGCAGGAGGATGACAGGCTGGGG - Intronic
957640934 3:82852534-82852556 TGCTGGAGGAACAGAAGCAGAGG + Intergenic
958977257 3:100682274-100682296 CCCAGGAGGAACTGGGTCTGGGG + Intronic
959399609 3:105883556-105883578 TGCAGGAGGAAATGGGCTTGAGG - Intergenic
959510521 3:107206413-107206435 TGCATGAGGAGCTAAGGCTCAGG - Intergenic
960058775 3:113297424-113297446 GATAGGAGGAAATGAGGCTGGGG - Intronic
960075906 3:113484991-113485013 TCCAGGAGGGACTGAGCCTGAGG + Intronic
960972738 3:123151180-123151202 TCAAGGAGGGGCTGAGGCTGTGG - Intronic
961112465 3:124296700-124296722 TCAAGGAGGAAGTGTGGCTGGGG - Intronic
961509269 3:127391130-127391152 AGGAGGAGGCACAGAGGCTGCGG + Intergenic
961580338 3:127875671-127875693 AGCAGCAGGAAGTGAGGCTGAGG - Intergenic
961746206 3:129064971-129064993 TGGGAGAGGCACTGAGGCTGGGG - Intergenic
962283478 3:134068891-134068913 AGATGGAGGAACTGAGGCTCAGG - Intronic
962386320 3:134935354-134935376 GGAAGGAGGAACTGAGCCTCTGG + Intronic
963835697 3:150056068-150056090 TGTCAGAGTAACTGAGGCTGTGG + Intergenic
966490018 3:180517026-180517048 TGGAGGAGGCAGTGAGGCTGGGG - Intergenic
966807745 3:183819768-183819790 TTCAGAAGAAACTGAGGCTCAGG - Intronic
967525973 3:190493119-190493141 TGCTGGAGGAATTTGGGCTGGGG - Intergenic
968577983 4:1376802-1376824 TGCGGCAGGAGCTGAGGCGGCGG - Intronic
968615004 4:1573763-1573785 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615013 4:1573797-1573819 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615018 4:1573815-1573837 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615027 4:1573849-1573871 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615036 4:1573883-1573905 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615041 4:1573901-1573923 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968615050 4:1573935-1573957 TGAGGGAGGAGCTGAGGGTGAGG - Intergenic
968795297 4:2699735-2699757 TCCAGGAGGAGCAGAGGCGGCGG + Exonic
968963968 4:3760169-3760191 ACCAGGAGGAGCTGAGGATGAGG - Intergenic
969116827 4:4875506-4875528 TTCAGAAGGAACTGGGGTTGGGG - Intergenic
969476482 4:7425127-7425149 TGTGGGAGGATCTGAGGCTCTGG - Intronic
969492722 4:7509329-7509351 AGCAGGGGGAAGAGAGGCTGTGG - Intronic
969693770 4:8723657-8723679 AGGAGCAGAAACTGAGGCTGGGG + Intergenic
972260966 4:37407961-37407983 GCCATGAGGAACTGAGCCTGAGG + Intronic
972422158 4:38898223-38898245 TGCAAGAGTACCTGAGGTTGGGG + Intronic
972570895 4:40309572-40309594 TGCAGGAGGAAGTGACACTTGGG - Intergenic
972606518 4:40618979-40619001 TGGAGGAAGGACTGAGGATGGGG - Intronic
973824162 4:54688384-54688406 AGCAGGAAGAACTGTGACTGGGG - Intronic
973824211 4:54688828-54688850 AGCAGGAAGAACTGTGACTGGGG - Intronic
973909260 4:55563160-55563182 AGCAGGAAGAGCTGAGGTTGTGG - Intronic
974103597 4:57443406-57443428 GGCAGGGGGAAGAGAGGCTGGGG - Intergenic
975834224 4:78404682-78404704 TGCAAGAGTAACTGAGGAAGTGG - Intronic
977154356 4:93554715-93554737 TGCAGTCATAACTGAGGCTGAGG - Intronic
980575714 4:134681905-134681927 GGGTGGAGGAGCTGAGGCTGAGG + Intergenic
982114051 4:152082447-152082469 TGCAGGAGGAATGGGGGCTTAGG + Intergenic
983469603 4:168140495-168140517 TGTAGGTGGAACATAGGCTGAGG - Intronic
983631451 4:169853479-169853501 AGCAGGAGGAAGAGGGGCTGGGG - Intergenic
984099130 4:175465432-175465454 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
984814652 4:183825256-183825278 TGCATGAGGAGGAGAGGCTGTGG + Intergenic
985554244 5:548483-548505 TCCTGGAGGAAGTGATGCTGGGG + Intergenic
985580753 5:694057-694079 TGCAGGGAGAACGGAAGCTGAGG - Intergenic
985589026 5:755314-755336 AGCAGGAGGAGCTGTGTCTGTGG + Intronic
985595375 5:785389-785411 TGCAGGGAGAACGGAAGCTGAGG - Intergenic
985661364 5:1158717-1158739 TGCTGGTGGAACTGAGTGTGTGG + Intergenic
985996879 5:3602071-3602093 TGAACGAGGGGCTGAGGCTGTGG + Intergenic
986066669 5:4240881-4240903 GAGGGGAGGAACTGAGGCTGGGG + Intergenic
986208422 5:5647845-5647867 AGCAGGAGAAACAGAGGCTCAGG - Intergenic
986215238 5:5713281-5713303 GACAGGAGGAACTGAGGTCGAGG + Intergenic
986437823 5:7751844-7751866 TGATAAAGGAACTGAGGCTGTGG - Intronic
986789275 5:11144412-11144434 TGCAGGTGGACCGGAGGCAGTGG - Intronic
987059853 5:14232261-14232283 GGCAGAAGGAACGGAGGCTATGG - Intronic
987401878 5:17486414-17486436 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987403124 5:17498412-17498434 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405305 5:17518548-17518570 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987405750 5:17521982-17522004 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987406197 5:17525416-17525438 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987407502 5:17585555-17585577 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987407753 5:17587320-17587342 TGCAGGAGGAGTTGAGGCTGAGG + Intergenic
987408200 5:17590757-17590779 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987408648 5:17594191-17594213 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987409104 5:17597625-17597647 TGCAGGAGGAGCTGAGGCTGAGG + Intergenic
987412893 5:17632269-17632291 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987413167 5:17634641-17634663 TGCAGGAGGAGCTGAGGCTGAGG - Intergenic
987414550 5:17649227-17649249 TGCAGGAGGAACTGAGGCTGAGG - Intergenic
990489833 5:56293938-56293960 TGCAGCAGGAACCGAGCTTGAGG + Intergenic
990489972 5:56294964-56294986 TGCAGCAGGAACCGAGCTTGAGG - Intergenic
990502191 5:56407706-56407728 TGCAAGAGAGACTGAGCCTGTGG - Intergenic
990673302 5:58156708-58156730 TGCAAGAGGACCTAAGGATGTGG + Intergenic
991534426 5:67650999-67651021 TGCTGGAGGCTGTGAGGCTGTGG + Intergenic
992151576 5:73909692-73909714 CGCAGGAGGAGCTGCTGCTGCGG + Exonic
993682669 5:90898999-90899021 AACAGGAGGAACTGAGGATGTGG + Intronic
996082208 5:119268721-119268743 TGCAGGAGGGACCAAGGGTGTGG - Intronic
996144229 5:119953802-119953824 AGCAGGAGTAGCTGAGGATGTGG + Intergenic
996386646 5:122915817-122915839 TACCTGAGGAACTGAGACTGTGG - Intronic
997259391 5:132454424-132454446 TGCAGGAGGAGCTCAGACTTGGG - Intronic
997878838 5:137572121-137572143 TGCAGCGGGAAGAGAGGCTGTGG - Intronic
997896465 5:137722314-137722336 TGCATGATGAACTGATGGTGGGG - Intronic
998388212 5:141770565-141770587 TCCAGAAGGGAGTGAGGCTGGGG + Intergenic
998388329 5:141771265-141771287 AGCAAGAGGAGCTGGGGCTGGGG + Intergenic
1000438507 5:161241654-161241676 GGGTGGAGGAACAGAGGCTGAGG - Intergenic
1000439641 5:161250178-161250200 GGGTGGAGGAACAGAGGCTGAGG - Intergenic
1001051943 5:168420747-168420769 TGCAGGAGCAGCTGAGGCTGAGG - Intronic
1001436538 5:171703706-171703728 AGCAGGAAGAGCAGAGGCTGTGG - Intergenic
1001578060 5:172777650-172777672 CACAGGGGGAACTGATGCTGCGG + Intergenic
1001686227 5:173596954-173596976 TGCAGGAGGGAGGGAGGCAGCGG - Intergenic
1002109036 5:176895648-176895670 TGCAGGAGGAACTGGAGAGGCGG + Intronic
1002334227 5:178466937-178466959 AGCTGGGGAAACTGAGGCTGTGG - Intronic
1002687342 5:181024112-181024134 AGCAGGATGCACTGTGGCTGTGG - Intergenic
1003183879 6:3813963-3813985 TGCAGCAGGGAGTGAGGTTGAGG + Intergenic
1003191908 6:3881692-3881714 TGCACAAGAAACTGGGGCTGGGG - Intergenic
1003344159 6:5250984-5251006 TGCAGAATGTACTGGGGCTGAGG - Intronic
1003459426 6:6316827-6316849 TGATGGAGAAACTGAGGCTTGGG + Intronic
1004628022 6:17394292-17394314 TGCAGAGGCAACTGAGACTGGGG + Intronic
1005264023 6:24092334-24092356 TGCAGGAGGAGTTGAGTGTGGGG - Intergenic
1006081841 6:31572383-31572405 TGCAGGAGGGACCGAGGCCCAGG - Intronic
1006792791 6:36714662-36714684 GGCAGGAGGAACTGCCGGTGGGG + Intronic
1006828827 6:36956503-36956525 AGGAGGAGGAGATGAGGCTGGGG + Intronic
1007280790 6:40710726-40710748 GGCTGGAGAAACTGAGGGTGGGG + Intergenic
1007737206 6:43989410-43989432 TGGAGTAGGGACTGAGGGTGTGG - Intergenic
1008026155 6:46638157-46638179 TACAGGGGGAACTGAAACTGTGG + Intronic
1008246314 6:49178342-49178364 AGCAGGAGGAAGAGAGGGTGAGG + Intergenic
1008347257 6:50442972-50442994 TTCAGGAGGAACTGATTGTGTGG - Intergenic
1008640252 6:53455029-53455051 TGAAGGAGGAGCAGAGTCTGAGG + Intergenic
1008850295 6:56014822-56014844 GGGTGGAGGAGCTGAGGCTGAGG + Intergenic
1009437604 6:63635995-63636017 CCCAGGAGGAAAAGAGGCTGTGG + Exonic
1009670548 6:66743324-66743346 TGCAGGAAGAAATGAAGCAGTGG - Intergenic
1009885415 6:69618474-69618496 GGCAGGAGAATCTGAGGCAGAGG + Intergenic
1010668250 6:78655273-78655295 GTCAGGAGGCACTGAGGTTGGGG + Intergenic
1011054755 6:83193376-83193398 CGCCTGAGGAACTGCGGCTGCGG + Exonic
1014255853 6:119159599-119159621 CCCAGTAGGAACTGAGGCTAGGG - Intergenic
1014494807 6:122108068-122108090 TGTAGGAGGAACTGAAGTGGGGG + Intergenic
1016416863 6:143842897-143842919 TGCCGTAGCAACGGAGGCTGGGG - Intronic
1016889696 6:148993759-148993781 AGCAGGAGCAAGTGAGGCTCAGG - Intronic
1018169316 6:161131966-161131988 TGCAGGAGGCAGGGATGCTGAGG + Exonic
1018258757 6:161949071-161949093 TGCTGGATGAACAGAGCCTGGGG + Intronic
1018608633 6:165624940-165624962 TGCAGGAGGGCCTGAGCCTCAGG + Intronic
1018630795 6:165820598-165820620 TGCAGGAGGACCAGACGCTGGGG - Intronic
1019005503 6:168793353-168793375 TGGAAGGGGAAGTGAGGCTGTGG - Intergenic
1019064337 6:169283544-169283566 GGCATGAGGAGATGAGGCTGTGG + Intergenic
1019183386 6:170207096-170207118 TGCAGGGAGCACAGAGGCTGTGG + Intergenic
1019183407 6:170207205-170207227 TGCAGGGAGCACAGAGGCTGTGG + Intergenic
1019391256 7:787843-787865 TGCAGGTGATTCTGAGGCTGCGG + Intergenic
1019578036 7:1746867-1746889 TGGAGGAGTAGCTCAGGCTGTGG - Exonic
1019624379 7:2008649-2008671 TGGAGGAGGGGCTGAGGCTGGGG - Intronic
1019903011 7:4038675-4038697 TGCAGGAGGAATTTTGGCTTTGG + Intronic
1020660754 7:10978734-10978756 TGGAGGTGGAGGTGAGGCTGGGG - Intronic
1020711676 7:11614004-11614026 TCCAGGAGTAACTGACCCTGTGG + Intronic
1020726700 7:11824193-11824215 TGAAGGAGGCACTGAGCATGTGG - Intronic
1022459722 7:30594110-30594132 GGCAGGAGGAACTGGGTGTGTGG + Intergenic
1022531585 7:31070192-31070214 TGCAGAAGGAACGGAGCCTGGGG - Intronic
1023829696 7:44031640-44031662 TGGAGGAGAAGCTGAGGCTTAGG - Intergenic
1023864918 7:44234008-44234030 TGGTGGAGGAGCTGAGGGTGGGG + Intronic
1024167447 7:46748908-46748930 TGCAGGAAGTGCTGAGCCTGAGG - Intronic
1024551329 7:50564927-50564949 TACAGAAGAAACAGAGGCTGGGG + Intronic
1024587792 7:50856476-50856498 TGCAGAAGGAACTGGAGCTCTGG - Intergenic
1025732669 7:64120266-64120288 TGCAGGACTCACTGATGCTGGGG - Intronic
1025926492 7:65964580-65964602 TGCAGGACTCACTGATGCTGGGG + Intronic
1026852864 7:73735805-73735827 TGGAGGAGAAACTGAGGCTGAGG + Intergenic
1028115912 7:86997395-86997417 TGGAGGATGAACAGAGGCGGAGG - Intronic
1028604378 7:92639722-92639744 AGCAGGAGGAATAGAGGCTGTGG - Intronic
1029510676 7:100992920-100992942 TCCAAGAAGAACTGAGGTTGTGG - Exonic
1029511167 7:100996169-100996191 TCCAAGAAGAACTGAGGTTGTGG - Exonic
1029511895 7:101000840-101000862 TCCAAGAAGAACTGAGGTTGTGG - Exonic
1029512070 7:101002013-101002035 TTCACGACGAACTGAGGTTGTGG - Exonic
1029512387 7:101004089-101004111 TCCAAGAAGAACTGAGGTTGTGG - Exonic
1029514369 7:101016673-101016695 AGGTGGAGGAAGTGAGGCTGAGG + Intronic
1029740006 7:102485899-102485921 TGGAGGAGAAGCTGAGGCTTAGG - Intronic
1029758003 7:102585078-102585100 TGGAGGAGAAGCTGAGGCTTAGG - Intronic
1029775940 7:102684139-102684161 TGGAGGAGAAGCTGAGGCTTAGG - Intergenic
1030065460 7:105655780-105655802 TCCCGGAGCAACTGGGGCTGAGG - Intronic
1030129534 7:106186520-106186542 TGCTTGAGGACCTGAGGCAGAGG - Intergenic
1030163700 7:106532435-106532457 GGGAGGGGGAACAGAGGCTGAGG + Intergenic
1030226057 7:107152275-107152297 AGCAGTAGGAAATGAGGTTGGGG - Intronic
1030620203 7:111781335-111781357 TGTGGGAGAAACTCAGGCTGAGG + Intronic
1030885768 7:114934964-114934986 TTCAGGAAGACCTGAGGCTCTGG - Intronic
1031109939 7:117596156-117596178 CGCTGGGGGAACTGGGGCTGCGG + Intronic
1031453701 7:121953902-121953924 TCCTGGAGGAAATGATGCTGTGG + Intronic
1032346884 7:131124670-131124692 GGCAGGAGGACCAGAGACTGAGG - Intronic
1033220249 7:139522930-139522952 AGCAGGAGGAGCTGGGGATGAGG + Intergenic
1034011099 7:147530622-147530644 TGTAGGAGGGACTGAGGGGGAGG - Intronic
1034174806 7:149091441-149091463 TGCAGGCGGCCCTGAGGCCGGGG - Intergenic
1034434632 7:151057494-151057516 TGCAGCAAGAAACGAGGCTGGGG + Intronic
1034543036 7:151771416-151771438 TGCAGGAGGAAAGGAGGAAGTGG - Intronic
1034592723 7:152156296-152156318 TGTAGGAGGAAGAGAGGCAGGGG + Exonic
1034918374 7:155059438-155059460 TGTAGTAGGAACTGGGGCAGTGG - Intergenic
1035379606 7:158429355-158429377 TGCAGGAGGAACAGCTGCTAAGG - Intronic
1035396005 7:158535035-158535057 TGCAGGAGGAACAGAGGCTTTGG - Intronic
1035493303 7:159298791-159298813 TGCAAGGGGCAGTGAGGCTGGGG + Intergenic
1035638639 8:1165220-1165242 GGCGGGAGGAACAGAGGCAGAGG + Intergenic
1035673645 8:1439283-1439305 GGAAGGAGGGACAGAGGCTGTGG + Intergenic
1036270902 8:7301919-7301941 TCCAGGATGAATTGAGGCTCTGG - Intergenic
1036350447 8:8008425-8008447 TCCAGGATGAATTGAGGCTCTGG + Intergenic
1036694794 8:10967506-10967528 TGCAGGCAGCACTGAGGCAGAGG + Intronic
1037804089 8:22049648-22049670 GGTAGGGGAAACTGAGGCTGGGG - Intronic
1037804103 8:22049700-22049722 GGAAGGGGAAACTGAGGCTGGGG - Intronic
1038362915 8:26900909-26900931 TGCAGAAGCCACTCAGGCTGTGG - Intergenic
1041181700 8:55256091-55256113 TGAAGGATGAGCTGAGGCTGAGG + Intronic
1041754298 8:61296781-61296803 TGTATGAGGCACTGAGGATGTGG + Intronic
1042705716 8:71664161-71664183 AGCAGGTGGAGCTGAGGGTGTGG - Intergenic
1045950458 8:107845901-107845923 TGCAGCAGGAGCTGTGGCTCAGG - Intergenic
1046487754 8:114909213-114909235 GGCAGCAGGGGCTGAGGCTGTGG - Intergenic
1047304662 8:123643012-123643034 TGAAGGAATACCTGAGGCTGGGG + Intergenic
1048213906 8:132479368-132479390 AGCAGCAGCGACTGAGGCTGAGG + Intronic
1048442874 8:134472756-134472778 TGCAGGAGCCCCAGAGGCTGGGG - Intergenic
1048494449 8:134923505-134923527 TGCAGGAGAAGCTGAGTCTCAGG + Intergenic
1048872047 8:138807215-138807237 TGAAAGAGGAACTGAGTGTGTGG - Intronic
1049284749 8:141768526-141768548 AGAGGGAGGAGCTGAGGCTGGGG - Intergenic
1049321788 8:142000682-142000704 TTCGGGAGGGGCTGAGGCTGGGG - Intergenic
1049389099 8:142358992-142359014 CGCAGCAAGAGCTGAGGCTGGGG - Intronic
1049415154 8:142491687-142491709 GCCAGGAGGGACTGGGGCTGAGG - Intronic
1049496066 8:142934187-142934209 CCCAGGAGGAGCAGAGGCTGTGG - Intergenic
1049499232 8:142952641-142952663 TGCAGGAGAAGCTGAGGCATGGG - Intergenic
1049603330 8:143518103-143518125 TGCAGGAGGGGCTGGCGCTGTGG + Intronic
1049706507 8:144045613-144045635 TGCAGGAGGAGCTTGGGCAGGGG + Intronic
1050162538 9:2733266-2733288 TGAAGCAGAAACTGAGGCTGAGG - Intronic
1050826445 9:9952049-9952071 TTGAGGAGGGACAGAGGCTGAGG + Intronic
1051516434 9:17935248-17935270 GGCAGGAGGAAAGGAGGGTGTGG - Intergenic
1051849370 9:21489700-21489722 GGGTGGAGGAACGGAGGCTGAGG + Intergenic
1052865621 9:33463186-33463208 TCCAGGTGAAGCTGAGGCTGTGG - Intronic
1053272956 9:36762722-36762744 TGCAGGAGGGAGCCAGGCTGGGG + Intergenic
1053449299 9:38179912-38179934 TGCAGGAGGAACGGAGGCTCTGG + Intergenic
1056487387 9:87072830-87072852 GGAAGCAGGCACTGAGGCTGAGG + Intergenic
1057083985 9:92192026-92192048 TGCAGCAGGAAATGGTGCTGAGG - Intergenic
1057900592 9:98944838-98944860 TGCTGGAGAAACTGAGGCCCGGG - Intronic
1058026289 9:100144702-100144724 GGGTGGAGGAGCTGAGGCTGAGG + Intronic
1058029034 9:100175661-100175683 GGCAGGAAGAATAGAGGCTGGGG - Intronic
1058744752 9:107979536-107979558 AGCAGGAGGAACTGATGTAGTGG + Intergenic
1059694888 9:116721673-116721695 TGCAGGAAGAACTGGGCCTTAGG - Intronic
1060055344 9:120408444-120408466 TGCAGGAGGAGGTGAAGTTGAGG - Exonic
1060541863 9:124436402-124436424 GTCAGGAGTCACTGAGGCTGGGG - Intergenic
1060602586 9:124888085-124888107 TGCAGGAGGAACGGAAGATCAGG + Intronic
1060735707 9:126065432-126065454 TGATGGAGGGGCTGAGGCTGGGG + Intergenic
1060911995 9:127358755-127358777 TGGAGGAGGAACACAGGCAGTGG - Intronic
1060964991 9:127707327-127707349 CGTATGAGGAAATGAGGCTGGGG - Intronic
1061104929 9:128522663-128522685 TTCAGGAGGGCCTGAGGCTATGG + Exonic
1061147443 9:128808198-128808220 AGAAGCAGGAACTGAGGCTGGGG - Exonic
1061230957 9:129315557-129315579 TGAAGGAGGAGCTGAGGCCGAGG - Intergenic
1061407097 9:130398498-130398520 TGCAGGGGGCACAGGGGCTGGGG - Intronic
1061415636 9:130445497-130445519 TCCAGGGTAAACTGAGGCTGCGG - Intronic
1061723761 9:132570141-132570163 TGCAGGAGGAAAATAGTCTGTGG - Intronic
1061731148 9:132615021-132615043 TGCAGAAGGAACAGGGGCTGTGG + Intronic
1061779987 9:132989718-132989740 TGCCGGAGGAAATGAGGCCCCGG - Intronic
1062281663 9:135754632-135754654 TGGATGAGGAACTGAGACTCGGG + Intronic
1062598156 9:137308334-137308356 TCAAGGAGGAGCTGGGGCTGGGG - Intronic
1203748163 Un_GL000218v1:55606-55628 GGCAGGAGCTACTTAGGCTGAGG - Intergenic
1185616705 X:1426419-1426441 TGCAGGAGGGACGCAGGCTTTGG - Intronic
1186490726 X:9970258-9970280 TGAAGGAGGAACAGAGGGAGGGG - Intergenic
1186908294 X:14134556-14134578 AGAAGGGGGAACTGAGGCTTAGG + Intergenic
1187510964 X:19919121-19919143 GGCAGGAGGATGTGAGGTTGGGG - Intronic
1189966163 X:46376078-46376100 AGCAGGTGAATCTGAGGCTGGGG - Intergenic
1191935560 X:66423711-66423733 TGCAGGCAGCAGTGAGGCTGGGG - Intergenic
1192539976 X:71959617-71959639 TGGAGGAGTAAGAGAGGCTGAGG - Intergenic
1193154366 X:78157596-78157618 TGCAAGTGGCAGTGAGGCTGGGG - Intergenic
1195064739 X:101230667-101230689 TGTAGCAGGAGGTGAGGCTGTGG - Intronic
1195163681 X:102196770-102196792 GCAAGGAGGAAGTGAGGCTGGGG - Intergenic
1195240566 X:102947596-102947618 TGCTGGTGGAACAGGGGCTGGGG + Intergenic
1195811250 X:108832920-108832942 TTCAGGAGGAATTGAGGCCTAGG - Intergenic
1197832878 X:130663584-130663606 TGCAGGAGGAAGGGAGCCTCTGG - Intronic
1197875378 X:131098573-131098595 TTAAGGAGGAACTCATGCTGAGG + Intergenic
1198276448 X:135098834-135098856 TGGAGGAGGGACCGAGGCAGTGG - Intergenic
1198406622 X:136319210-136319232 TGCTGGAGGCCCAGAGGCTGCGG + Intronic
1198801112 X:140448644-140448666 TGCAGGAGAAACTGAGGCCATGG - Intergenic
1198821633 X:140654221-140654243 TGCAGTAAGAATTGAGGCTGAGG + Intergenic
1200226458 X:154420347-154420369 TGCAGGAGGAGCTGAGCATGAGG + Intronic