ID: 987419677

View in Genome Browser
Species Human (GRCh38)
Location 5:17704381-17704403
Sequence TGTTTTTCCCTTACAAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987419677_987419678 -1 Left 987419677 5:17704381-17704403 CCTATTTTTGTAAGGGAAAAACA No data
Right 987419678 5:17704403-17704425 ACTTTTCAAATTACATTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987419677 Original CRISPR TGTTTTTCCCTTACAAAAAT AGG (reversed) Intergenic
No off target data available for this crispr