ID: 987421742

View in Genome Browser
Species Human (GRCh38)
Location 5:17728867-17728889
Sequence CCAGATCCAGACCTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987421742_987421750 14 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421750 5:17728904-17728926 CCATGGGAAGCCAGAAGGCTGGG No data
987421742_987421745 -3 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421745 5:17728887-17728909 TGGAAAGTGAGCAGAGGCCATGG No data
987421742_987421751 20 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421751 5:17728910-17728932 GAAGCCAGAAGGCTGGGATCAGG No data
987421742_987421744 -9 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421744 5:17728881-17728903 TGGATCTGGAAAGTGAGCAGAGG No data
987421742_987421746 -2 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421746 5:17728888-17728910 GGAAAGTGAGCAGAGGCCATGGG No data
987421742_987421748 13 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421748 5:17728903-17728925 GCCATGGGAAGCCAGAAGGCTGG No data
987421742_987421747 9 Left 987421742 5:17728867-17728889 CCAGGCTCTAGGTCTGGATCTGG No data
Right 987421747 5:17728899-17728921 AGAGGCCATGGGAAGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987421742 Original CRISPR CCAGATCCAGACCTAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr