ID: 987424366

View in Genome Browser
Species Human (GRCh38)
Location 5:17756174-17756196
Sequence GTCCTTGATGTGTCTAAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987424358_987424366 22 Left 987424358 5:17756129-17756151 CCAGCTTCTGTTGTCTATGCTCC No data
Right 987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG No data
987424363_987424366 -4 Left 987424363 5:17756155-17756177 CCTCCTCTGGATGGCTTCTGTCC No data
Right 987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG No data
987424364_987424366 -7 Left 987424364 5:17756158-17756180 CCTCTGGATGGCTTCTGTCCTTG No data
Right 987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG No data
987424362_987424366 0 Left 987424362 5:17756151-17756173 CCTTCCTCCTCTGGATGGCTTCT No data
Right 987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG No data
987424361_987424366 1 Left 987424361 5:17756150-17756172 CCCTTCCTCCTCTGGATGGCTTC No data
Right 987424366 5:17756174-17756196 GTCCTTGATGTGTCTAAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987424366 Original CRISPR GTCCTTGATGTGTCTAAGGC TGG Intergenic
No off target data available for this crispr