ID: 987430241

View in Genome Browser
Species Human (GRCh38)
Location 5:17824181-17824203
Sequence TTGAATAAGAGTGATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987430241_987430246 29 Left 987430241 5:17824181-17824203 CCTCCCTCATCACTCTTATTCAA No data
Right 987430246 5:17824233-17824255 TCGGCAAGAGAAAGAAAGAATGG No data
987430241_987430244 10 Left 987430241 5:17824181-17824203 CCTCCCTCATCACTCTTATTCAA No data
Right 987430244 5:17824214-17824236 AAAATCTTAGCCAGAGAAATCGG No data
987430241_987430247 30 Left 987430241 5:17824181-17824203 CCTCCCTCATCACTCTTATTCAA No data
Right 987430247 5:17824234-17824256 CGGCAAGAGAAAGAAAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987430241 Original CRISPR TTGAATAAGAGTGATGAGGG AGG (reversed) Intergenic
No off target data available for this crispr