ID: 987432758

View in Genome Browser
Species Human (GRCh38)
Location 5:17856633-17856655
Sequence AAATCTCTTTTAGAGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987432758_987432762 -6 Left 987432758 5:17856633-17856655 CCAGGCCCCTCTAAAAGAGATTT No data
Right 987432762 5:17856650-17856672 AGATTTAGAACAAAGACTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987432758 Original CRISPR AAATCTCTTTTAGAGGGGCC TGG (reversed) Intergenic
No off target data available for this crispr