ID: 987434136

View in Genome Browser
Species Human (GRCh38)
Location 5:17872934-17872956
Sequence GTTTTCAGCTGAAGTTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987434136_987434139 1 Left 987434136 5:17872934-17872956 CCTCCTGAACTTCAGCTGAAAAC No data
Right 987434139 5:17872958-17872980 TTTTTCCAAACTGTAAACTAGGG No data
987434136_987434138 0 Left 987434136 5:17872934-17872956 CCTCCTGAACTTCAGCTGAAAAC No data
Right 987434138 5:17872957-17872979 TTTTTTCCAAACTGTAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987434136 Original CRISPR GTTTTCAGCTGAAGTTCAGG AGG (reversed) Intergenic
No off target data available for this crispr