ID: 987434138

View in Genome Browser
Species Human (GRCh38)
Location 5:17872957-17872979
Sequence TTTTTTCCAAACTGTAAACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987434136_987434138 0 Left 987434136 5:17872934-17872956 CCTCCTGAACTTCAGCTGAAAAC No data
Right 987434138 5:17872957-17872979 TTTTTTCCAAACTGTAAACTAGG No data
987434134_987434138 7 Left 987434134 5:17872927-17872949 CCTTGGCCCTCCTGAACTTCAGC No data
Right 987434138 5:17872957-17872979 TTTTTTCCAAACTGTAAACTAGG No data
987434135_987434138 1 Left 987434135 5:17872933-17872955 CCCTCCTGAACTTCAGCTGAAAA No data
Right 987434138 5:17872957-17872979 TTTTTTCCAAACTGTAAACTAGG No data
987434137_987434138 -3 Left 987434137 5:17872937-17872959 CCTGAACTTCAGCTGAAAACTTT No data
Right 987434138 5:17872957-17872979 TTTTTTCCAAACTGTAAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987434138 Original CRISPR TTTTTTCCAAACTGTAAACT AGG Intergenic
No off target data available for this crispr