ID: 987434139

View in Genome Browser
Species Human (GRCh38)
Location 5:17872958-17872980
Sequence TTTTTCCAAACTGTAAACTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987434137_987434139 -2 Left 987434137 5:17872937-17872959 CCTGAACTTCAGCTGAAAACTTT No data
Right 987434139 5:17872958-17872980 TTTTTCCAAACTGTAAACTAGGG No data
987434135_987434139 2 Left 987434135 5:17872933-17872955 CCCTCCTGAACTTCAGCTGAAAA No data
Right 987434139 5:17872958-17872980 TTTTTCCAAACTGTAAACTAGGG No data
987434136_987434139 1 Left 987434136 5:17872934-17872956 CCTCCTGAACTTCAGCTGAAAAC No data
Right 987434139 5:17872958-17872980 TTTTTCCAAACTGTAAACTAGGG No data
987434134_987434139 8 Left 987434134 5:17872927-17872949 CCTTGGCCCTCCTGAACTTCAGC No data
Right 987434139 5:17872958-17872980 TTTTTCCAAACTGTAAACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987434139 Original CRISPR TTTTTCCAAACTGTAAACTA GGG Intergenic
No off target data available for this crispr