ID: 987434221 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:17874442-17874464 |
| Sequence | TCACCTGGCAGGTAGAATCA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987434221_987434224 | -1 | Left | 987434221 | 5:17874442-17874464 | CCATGATTCTACCTGCCAGGTGA | No data | ||
| Right | 987434224 | 5:17874464-17874486 | AGCCCATTTTTAAAAATAGTTGG | No data | ||||
| 987434221_987434227 | 12 | Left | 987434221 | 5:17874442-17874464 | CCATGATTCTACCTGCCAGGTGA | No data | ||
| Right | 987434227 | 5:17874477-17874499 | AAATAGTTGGTCCATAAATGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987434221 | Original CRISPR | TCACCTGGCAGGTAGAATCA TGG (reversed) | Intergenic | ||