ID: 987434221

View in Genome Browser
Species Human (GRCh38)
Location 5:17874442-17874464
Sequence TCACCTGGCAGGTAGAATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987434221_987434224 -1 Left 987434221 5:17874442-17874464 CCATGATTCTACCTGCCAGGTGA No data
Right 987434224 5:17874464-17874486 AGCCCATTTTTAAAAATAGTTGG No data
987434221_987434227 12 Left 987434221 5:17874442-17874464 CCATGATTCTACCTGCCAGGTGA No data
Right 987434227 5:17874477-17874499 AAATAGTTGGTCCATAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987434221 Original CRISPR TCACCTGGCAGGTAGAATCA TGG (reversed) Intergenic