ID: 987435918

View in Genome Browser
Species Human (GRCh38)
Location 5:17894141-17894163
Sequence ATAGGCTTGGTACAGTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987435918_987435923 15 Left 987435918 5:17894141-17894163 CCATCTGACTGTACCAAGCCTAT No data
Right 987435923 5:17894179-17894201 CGCAAATCAGCACAGGTAGAAGG No data
987435918_987435924 24 Left 987435918 5:17894141-17894163 CCATCTGACTGTACCAAGCCTAT No data
Right 987435924 5:17894188-17894210 GCACAGGTAGAAGGACCACATGG No data
987435918_987435922 8 Left 987435918 5:17894141-17894163 CCATCTGACTGTACCAAGCCTAT No data
Right 987435922 5:17894172-17894194 GAGGAAGCGCAAATCAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987435918 Original CRISPR ATAGGCTTGGTACAGTCAGA TGG (reversed) Intergenic
No off target data available for this crispr