ID: 987436903

View in Genome Browser
Species Human (GRCh38)
Location 5:17905937-17905959
Sequence CCTTGGGAACATAAGTCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987436903_987436911 17 Left 987436903 5:17905937-17905959 CCAATGGACTTATGTTCCCAAGG No data
Right 987436911 5:17905977-17905999 GCTGCATCACATAGGTAACCAGG No data
987436903_987436912 18 Left 987436903 5:17905937-17905959 CCAATGGACTTATGTTCCCAAGG No data
Right 987436912 5:17905978-17906000 CTGCATCACATAGGTAACCAGGG No data
987436903_987436914 27 Left 987436903 5:17905937-17905959 CCAATGGACTTATGTTCCCAAGG No data
Right 987436914 5:17905987-17906009 ATAGGTAACCAGGGAAGTGAGGG No data
987436903_987436913 26 Left 987436903 5:17905937-17905959 CCAATGGACTTATGTTCCCAAGG No data
Right 987436913 5:17905986-17906008 CATAGGTAACCAGGGAAGTGAGG No data
987436903_987436910 9 Left 987436903 5:17905937-17905959 CCAATGGACTTATGTTCCCAAGG No data
Right 987436910 5:17905969-17905991 CTGTCTCTGCTGCATCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987436903 Original CRISPR CCTTGGGAACATAAGTCCAT TGG (reversed) Intergenic
No off target data available for this crispr