ID: 987441924

View in Genome Browser
Species Human (GRCh38)
Location 5:17967214-17967236
Sequence AGGAGCCATGGGTTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441924_987441938 16 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441938 5:17967253-17967275 GCCACTGTTTCTCATTGCATGGG No data
987441924_987441937 15 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441937 5:17967252-17967274 TGCCACTGTTTCTCATTGCATGG No data
987441924_987441941 28 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441924_987441940 17 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441940 5:17967254-17967276 CCACTGTTTCTCATTGCATGGGG No data
987441924_987441933 -10 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441933 5:17967227-17967249 CATGGCTCCTGGGCTGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441924 Original CRISPR AGGAGCCATGGGTTGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr