ID: 987441925

View in Genome Browser
Species Human (GRCh38)
Location 5:17967215-17967237
Sequence CAGGAGCCATGGGTTGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441925_987441941 27 Left 987441925 5:17967215-17967237 CCTGCTCCAACCCATGGCTCCTG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441925_987441938 15 Left 987441925 5:17967215-17967237 CCTGCTCCAACCCATGGCTCCTG No data
Right 987441938 5:17967253-17967275 GCCACTGTTTCTCATTGCATGGG No data
987441925_987441937 14 Left 987441925 5:17967215-17967237 CCTGCTCCAACCCATGGCTCCTG No data
Right 987441937 5:17967252-17967274 TGCCACTGTTTCTCATTGCATGG No data
987441925_987441940 16 Left 987441925 5:17967215-17967237 CCTGCTCCAACCCATGGCTCCTG No data
Right 987441940 5:17967254-17967276 CCACTGTTTCTCATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441925 Original CRISPR CAGGAGCCATGGGTTGGAGC AGG (reversed) Intergenic
No off target data available for this crispr