ID: 987441930

View in Genome Browser
Species Human (GRCh38)
Location 5:17967225-17967247
Sequence CAGGCCAGCCCAGGAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441930_987441942 29 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441942 5:17967277-17967299 CAGCTACCTGGCACCTGCACTGG No data
987441930_987441938 5 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441938 5:17967253-17967275 GCCACTGTTTCTCATTGCATGGG No data
987441930_987441941 17 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441930_987441940 6 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441940 5:17967254-17967276 CCACTGTTTCTCATTGCATGGGG No data
987441930_987441937 4 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441937 5:17967252-17967274 TGCCACTGTTTCTCATTGCATGG No data
987441930_987441943 30 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441943 5:17967278-17967300 AGCTACCTGGCACCTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441930 Original CRISPR CAGGCCAGCCCAGGAGCCAT GGG (reversed) Intergenic
No off target data available for this crispr