ID: 987441931

View in Genome Browser
Species Human (GRCh38)
Location 5:17967226-17967248
Sequence CCAGGCCAGCCCAGGAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441931_987441943 29 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441943 5:17967278-17967300 AGCTACCTGGCACCTGCACTGGG No data
987441931_987441937 3 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441937 5:17967252-17967274 TGCCACTGTTTCTCATTGCATGG No data
987441931_987441941 16 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441931_987441938 4 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441938 5:17967253-17967275 GCCACTGTTTCTCATTGCATGGG No data
987441931_987441942 28 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441942 5:17967277-17967299 CAGCTACCTGGCACCTGCACTGG No data
987441931_987441940 5 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441940 5:17967254-17967276 CCACTGTTTCTCATTGCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441931 Original CRISPR CCAGGCCAGCCCAGGAGCCA TGG (reversed) Intergenic
No off target data available for this crispr