ID: 987441934

View in Genome Browser
Species Human (GRCh38)
Location 5:17967234-17967256
Sequence TGGCAGGCCCAGGCCAGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441934_987441944 25 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441944 5:17967282-17967304 ACCTGGCACCTGCACTGGGTAGG No data
987441934_987441937 -5 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441937 5:17967252-17967274 TGCCACTGTTTCTCATTGCATGG No data
987441934_987441946 28 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441946 5:17967285-17967307 TGGCACCTGCACTGGGTAGGAGG No data
987441934_987441942 20 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441942 5:17967277-17967299 CAGCTACCTGGCACCTGCACTGG No data
987441934_987441941 8 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441934_987441947 29 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441947 5:17967286-17967308 GGCACCTGCACTGGGTAGGAGGG No data
987441934_987441938 -4 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441938 5:17967253-17967275 GCCACTGTTTCTCATTGCATGGG No data
987441934_987441940 -3 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441940 5:17967254-17967276 CCACTGTTTCTCATTGCATGGGG No data
987441934_987441943 21 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441943 5:17967278-17967300 AGCTACCTGGCACCTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441934 Original CRISPR TGGCAGGCCCAGGCCAGCCC AGG (reversed) Intergenic
No off target data available for this crispr