ID: 987441935

View in Genome Browser
Species Human (GRCh38)
Location 5:17967244-17967266
Sequence TGAGAAACAGTGGCAGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441935_987441947 19 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441947 5:17967286-17967308 GGCACCTGCACTGGGTAGGAGGG No data
987441935_987441946 18 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441946 5:17967285-17967307 TGGCACCTGCACTGGGTAGGAGG No data
987441935_987441943 11 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441943 5:17967278-17967300 AGCTACCTGGCACCTGCACTGGG No data
987441935_987441944 15 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441944 5:17967282-17967304 ACCTGGCACCTGCACTGGGTAGG No data
987441935_987441941 -2 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441935_987441942 10 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441942 5:17967277-17967299 CAGCTACCTGGCACCTGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441935 Original CRISPR TGAGAAACAGTGGCAGGCCC AGG (reversed) Intergenic
No off target data available for this crispr