ID: 987441936

View in Genome Browser
Species Human (GRCh38)
Location 5:17967250-17967272
Sequence ATGCAATGAGAAACAGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441936_987441947 13 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441947 5:17967286-17967308 GGCACCTGCACTGGGTAGGAGGG No data
987441936_987441943 5 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441943 5:17967278-17967300 AGCTACCTGGCACCTGCACTGGG No data
987441936_987441944 9 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441944 5:17967282-17967304 ACCTGGCACCTGCACTGGGTAGG No data
987441936_987441946 12 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441946 5:17967285-17967307 TGGCACCTGCACTGGGTAGGAGG No data
987441936_987441942 4 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441942 5:17967277-17967299 CAGCTACCTGGCACCTGCACTGG No data
987441936_987441941 -8 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441936 Original CRISPR ATGCAATGAGAAACAGTGGC AGG (reversed) Intergenic
No off target data available for this crispr