ID: 987441941

View in Genome Browser
Species Human (GRCh38)
Location 5:17967265-17967287
Sequence CATTGCATGGGGCAGCTACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987441925_987441941 27 Left 987441925 5:17967215-17967237 CCTGCTCCAACCCATGGCTCCTG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441928_987441941 21 Left 987441928 5:17967221-17967243 CCAACCCATGGCTCCTGGGCTGG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441931_987441941 16 Left 987441931 5:17967226-17967248 CCATGGCTCCTGGGCTGGCCTGG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441930_987441941 17 Left 987441930 5:17967225-17967247 CCCATGGCTCCTGGGCTGGCCTG No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441936_987441941 -8 Left 987441936 5:17967250-17967272 CCTGCCACTGTTTCTCATTGCAT No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441924_987441941 28 Left 987441924 5:17967214-17967236 CCCTGCTCCAACCCATGGCTCCT No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441934_987441941 8 Left 987441934 5:17967234-17967256 CCTGGGCTGGCCTGGGCCTGCCA No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data
987441935_987441941 -2 Left 987441935 5:17967244-17967266 CCTGGGCCTGCCACTGTTTCTCA No data
Right 987441941 5:17967265-17967287 CATTGCATGGGGCAGCTACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987441941 Original CRISPR CATTGCATGGGGCAGCTACC TGG Intergenic
No off target data available for this crispr