ID: 987443277

View in Genome Browser
Species Human (GRCh38)
Location 5:17984160-17984182
Sequence TTTCCAAGGCTACACCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987443274_987443277 27 Left 987443274 5:17984110-17984132 CCTCATTTCATAATTTAAAAAAT No data
Right 987443277 5:17984160-17984182 TTTCCAAGGCTACACCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987443277 Original CRISPR TTTCCAAGGCTACACCAGAC TGG Intergenic
No off target data available for this crispr