ID: 987445397

View in Genome Browser
Species Human (GRCh38)
Location 5:18011510-18011532
Sequence GGAAAGAAGCAGCATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987445394_987445397 12 Left 987445394 5:18011475-18011497 CCATTGTACCGCAACTATAGACA No data
Right 987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG No data
987445395_987445397 4 Left 987445395 5:18011483-18011505 CCGCAACTATAGACAAGCTAAAA No data
Right 987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987445397 Original CRISPR GGAAAGAAGCAGCATGAAGA AGG Intergenic
No off target data available for this crispr