ID: 987451565

View in Genome Browser
Species Human (GRCh38)
Location 5:18090522-18090544
Sequence ATGTTCGAACCTAATACATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987451565_987451568 -9 Left 987451565 5:18090522-18090544 CCTCATGTATTAGGTTCGAACAT No data
Right 987451568 5:18090536-18090558 TTCGAACATACAAATTTTAGGGG No data
987451565_987451567 -10 Left 987451565 5:18090522-18090544 CCTCATGTATTAGGTTCGAACAT No data
Right 987451567 5:18090535-18090557 GTTCGAACATACAAATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987451565 Original CRISPR ATGTTCGAACCTAATACATG AGG (reversed) Intergenic
No off target data available for this crispr