ID: 987456174

View in Genome Browser
Species Human (GRCh38)
Location 5:18149889-18149911
Sequence ATTCACTTGCTCCCAAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987456174_987456178 23 Left 987456174 5:18149889-18149911 CCTTTCCTTGGGAGCAAGTGAAT No data
Right 987456178 5:18149935-18149957 AAGATATGAGTCAAATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987456174 Original CRISPR ATTCACTTGCTCCCAAGGAA AGG (reversed) Intergenic
No off target data available for this crispr