ID: 987458979

View in Genome Browser
Species Human (GRCh38)
Location 5:18183879-18183901
Sequence GCTATTCAGCATCACAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987458976_987458979 29 Left 987458976 5:18183827-18183849 CCCAAAATGAAATTTTAAAAGAA No data
Right 987458979 5:18183879-18183901 GCTATTCAGCATCACAGTGAAGG No data
987458977_987458979 28 Left 987458977 5:18183828-18183850 CCAAAATGAAATTTTAAAAGAAG No data
Right 987458979 5:18183879-18183901 GCTATTCAGCATCACAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987458979 Original CRISPR GCTATTCAGCATCACAGTGA AGG Intergenic
No off target data available for this crispr