ID: 987460776

View in Genome Browser
Species Human (GRCh38)
Location 5:18207005-18207027
Sequence GATAGAAAAGAGCAGCTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987460776_987460779 5 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460779 5:18207033-18207055 AGCTGTCCCTGATCTTTCTTGGG No data
987460776_987460780 9 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460780 5:18207037-18207059 GTCCCTGATCTTTCTTGGGATGG No data
987460776_987460783 14 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460783 5:18207042-18207064 TGATCTTTCTTGGGATGGACAGG No data
987460776_987460784 20 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460784 5:18207048-18207070 TTCTTGGGATGGACAGGCTCTGG No data
987460776_987460778 4 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460778 5:18207032-18207054 CAGCTGTCCCTGATCTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987460776 Original CRISPR GATAGAAAAGAGCAGCTACA TGG (reversed) Intergenic
No off target data available for this crispr