ID: 987460780

View in Genome Browser
Species Human (GRCh38)
Location 5:18207037-18207059
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987460776_987460780 9 Left 987460776 5:18207005-18207027 CCATGTAGCTGCTCTTTTCTATC No data
Right 987460780 5:18207037-18207059 GTCCCTGATCTTTCTTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr