ID: 987464469

View in Genome Browser
Species Human (GRCh38)
Location 5:18255174-18255196
Sequence TGACACAGCATGGAAAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987464462_987464469 21 Left 987464462 5:18255130-18255152 CCCCTGTGCAATTTTGAAAGCAG No data
Right 987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG No data
987464467_987464469 -8 Left 987464467 5:18255159-18255181 CCTTCAAGTATGATATGACACAG No data
Right 987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG No data
987464465_987464469 19 Left 987464465 5:18255132-18255154 CCTGTGCAATTTTGAAAGCAGGG No data
Right 987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG No data
987464463_987464469 20 Left 987464463 5:18255131-18255153 CCCTGTGCAATTTTGAAAGCAGG No data
Right 987464469 5:18255174-18255196 TGACACAGCATGGAAAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987464469 Original CRISPR TGACACAGCATGGAAAAAAA TGG Intergenic
No off target data available for this crispr