ID: 987474910

View in Genome Browser
Species Human (GRCh38)
Location 5:18379033-18379055
Sequence GAATTTAAACTGAACCATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987474908_987474910 -4 Left 987474908 5:18379014-18379036 CCTCTCAATGGAATATCAAGAAT No data
Right 987474910 5:18379033-18379055 GAATTTAAACTGAACCATCAGGG No data
987474907_987474910 -3 Left 987474907 5:18379013-18379035 CCCTCTCAATGGAATATCAAGAA No data
Right 987474910 5:18379033-18379055 GAATTTAAACTGAACCATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987474910 Original CRISPR GAATTTAAACTGAACCATCA GGG Intergenic
No off target data available for this crispr