ID: 987476036

View in Genome Browser
Species Human (GRCh38)
Location 5:18393536-18393558
Sequence CTCACACAGGTGCTCACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987476036_987476042 6 Left 987476036 5:18393536-18393558 CCCACTGTGAGCACCTGTGTGAG No data
Right 987476042 5:18393565-18393587 AGGCTGCTCAGTCCTCACCATGG No data
987476036_987476044 21 Left 987476036 5:18393536-18393558 CCCACTGTGAGCACCTGTGTGAG No data
Right 987476044 5:18393580-18393602 CACCATGGCGAACTGTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987476036 Original CRISPR CTCACACAGGTGCTCACAGT GGG (reversed) Intergenic
No off target data available for this crispr