ID: 987485791

View in Genome Browser
Species Human (GRCh38)
Location 5:18524299-18524321
Sequence GTCCCACTTGTTGCTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987485789_987485791 4 Left 987485789 5:18524272-18524294 CCTTTTTCTTTGTTTTTTAGAGA No data
Right 987485791 5:18524299-18524321 GTCCCACTTGTTGCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987485791 Original CRISPR GTCCCACTTGTTGCTCAGGC TGG Intergenic
No off target data available for this crispr