ID: 987492167

View in Genome Browser
Species Human (GRCh38)
Location 5:18594926-18594948
Sequence TATCTAAGGCTGCATCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987492163_987492167 -3 Left 987492163 5:18594906-18594928 CCCAATAAGTTCCTCATCTCTAT 0: 30
1: 415
2: 1933
3: 2150
4: 1592
Right 987492167 5:18594926-18594948 TATCTAAGGCTGCATCAGCCTGG No data
987492164_987492167 -4 Left 987492164 5:18594907-18594929 CCAATAAGTTCCTCATCTCTATC 0: 31
1: 403
2: 1942
3: 2308
4: 1633
Right 987492167 5:18594926-18594948 TATCTAAGGCTGCATCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987492167 Original CRISPR TATCTAAGGCTGCATCAGCC TGG Intergenic
No off target data available for this crispr