ID: 987493023

View in Genome Browser
Species Human (GRCh38)
Location 5:18605343-18605365
Sequence ATGTGACTCACAGTCACCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987493023_987493025 8 Left 987493023 5:18605343-18605365 CCTTTGGTGACTGTGAGTCACAT No data
Right 987493025 5:18605374-18605396 GTCAGAATGTCCCTCCCTGGTGG No data
987493023_987493030 28 Left 987493023 5:18605343-18605365 CCTTTGGTGACTGTGAGTCACAT No data
Right 987493030 5:18605394-18605416 TGGTTTCTTGCACTTGACTGTGG No data
987493023_987493024 5 Left 987493023 5:18605343-18605365 CCTTTGGTGACTGTGAGTCACAT No data
Right 987493024 5:18605371-18605393 AAAGTCAGAATGTCCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987493023 Original CRISPR ATGTGACTCACAGTCACCAA AGG (reversed) Intergenic
No off target data available for this crispr