ID: 987504385

View in Genome Browser
Species Human (GRCh38)
Location 5:18749824-18749846
Sequence AGTTAACTACAGAAGATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987504385_987504389 13 Left 987504385 5:18749824-18749846 CCTGTCATCTTCTGTAGTTAACT No data
Right 987504389 5:18749860-18749882 GAGACAACTCTTGGCCTACTGGG No data
987504385_987504388 12 Left 987504385 5:18749824-18749846 CCTGTCATCTTCTGTAGTTAACT No data
Right 987504388 5:18749859-18749881 AGAGACAACTCTTGGCCTACTGG No data
987504385_987504391 22 Left 987504385 5:18749824-18749846 CCTGTCATCTTCTGTAGTTAACT No data
Right 987504391 5:18749869-18749891 CTTGGCCTACTGGGCTTTGGTGG No data
987504385_987504386 4 Left 987504385 5:18749824-18749846 CCTGTCATCTTCTGTAGTTAACT No data
Right 987504386 5:18749851-18749873 TCCTTTTGAGAGACAACTCTTGG 0: 17
1: 200
2: 191
3: 170
4: 310
987504385_987504390 19 Left 987504385 5:18749824-18749846 CCTGTCATCTTCTGTAGTTAACT No data
Right 987504390 5:18749866-18749888 ACTCTTGGCCTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987504385 Original CRISPR AGTTAACTACAGAAGATGAC AGG (reversed) Intergenic
No off target data available for this crispr