ID: 987506053

View in Genome Browser
Species Human (GRCh38)
Location 5:18774397-18774419
Sequence AATGTAATCAGACCAAAATA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987506053_987506058 30 Left 987506053 5:18774397-18774419 CCCTATTTTGGTCTGATTACATT No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987506053 Original CRISPR AATGTAATCAGACCAAAATA GGG (reversed) Intergenic
No off target data available for this crispr