ID: 987506058

View in Genome Browser
Species Human (GRCh38)
Location 5:18774450-18774472
Sequence AAAATCTGTGAATTATAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987506057_987506058 -10 Left 987506057 5:18774437-18774459 CCTTGTTTGTCACAAAATCTGTG No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data
987506054_987506058 29 Left 987506054 5:18774398-18774420 CCTATTTTGGTCTGATTACATTT No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data
987506056_987506058 -2 Left 987506056 5:18774429-18774451 CCTTGATTCCTTGTTTGTCACAA No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data
987506053_987506058 30 Left 987506053 5:18774397-18774419 CCCTATTTTGGTCTGATTACATT No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data
987506055_987506058 -1 Left 987506055 5:18774428-18774450 CCCTTGATTCCTTGTTTGTCACA No data
Right 987506058 5:18774450-18774472 AAAATCTGTGAATTATAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987506058 Original CRISPR AAAATCTGTGAATTATAATT TGG Intergenic
No off target data available for this crispr