ID: 987520645

View in Genome Browser
Species Human (GRCh38)
Location 5:18978869-18978891
Sequence TATTCCACCCTAAACGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987520645_987520650 22 Left 987520645 5:18978869-18978891 CCTTCACCGTTTAGGGTGGAATA No data
Right 987520650 5:18978914-18978936 TTGTTGCTGTAGGAAATAATTGG No data
987520645_987520649 12 Left 987520645 5:18978869-18978891 CCTTCACCGTTTAGGGTGGAATA No data
Right 987520649 5:18978904-18978926 TCATTCTCTTTTGTTGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987520645 Original CRISPR TATTCCACCCTAAACGGTGA AGG (reversed) Intergenic
No off target data available for this crispr