ID: 987522742 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:19007972-19007994 |
Sequence | TGAACACCTTCCAAATATTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
987522742_987522745 | -8 | Left | 987522742 | 5:19007972-19007994 | CCCAAATATTTGGAAGGTGTTCA | No data | ||
Right | 987522745 | 5:19007987-19008009 | GGTGTTCAAAAATGCTCATTGGG | No data | ||||
987522742_987522744 | -9 | Left | 987522742 | 5:19007972-19007994 | CCCAAATATTTGGAAGGTGTTCA | No data | ||
Right | 987522744 | 5:19007986-19008008 | AGGTGTTCAAAAATGCTCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
987522742 | Original CRISPR | TGAACACCTTCCAAATATTT GGG (reversed) | Intergenic | ||