ID: 987522743 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:19007973-19007995 |
| Sequence | TTGAACACCTTCCAAATATT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987522743_987522745 | -9 | Left | 987522743 | 5:19007973-19007995 | CCAAATATTTGGAAGGTGTTCAA | No data | ||
| Right | 987522745 | 5:19007987-19008009 | GGTGTTCAAAAATGCTCATTGGG | No data | ||||
| 987522743_987522744 | -10 | Left | 987522743 | 5:19007973-19007995 | CCAAATATTTGGAAGGTGTTCAA | No data | ||
| Right | 987522744 | 5:19007986-19008008 | AGGTGTTCAAAAATGCTCATTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987522743 | Original CRISPR | TTGAACACCTTCCAAATATT TGG (reversed) | Intergenic | ||