ID: 987522744

View in Genome Browser
Species Human (GRCh38)
Location 5:19007986-19008008
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987522743_987522744 -10 Left 987522743 5:19007973-19007995 CCAAATATTTGGAAGGTGTTCAA No data
Right 987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG No data
987522742_987522744 -9 Left 987522742 5:19007972-19007994 CCCAAATATTTGGAAGGTGTTCA No data
Right 987522744 5:19007986-19008008 AGGTGTTCAAAAATGCTCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type