ID: 987524651

View in Genome Browser
Species Human (GRCh38)
Location 5:19031505-19031527
Sequence CTCAAACACAACTCCAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987524649_987524651 12 Left 987524649 5:19031470-19031492 CCCTTTAGGGGTCAGAGCAAATC No data
Right 987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG No data
987524650_987524651 11 Left 987524650 5:19031471-19031493 CCTTTAGGGGTCAGAGCAAATCT No data
Right 987524651 5:19031505-19031527 CTCAAACACAACTCCAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987524651 Original CRISPR CTCAAACACAACTCCAGTAA AGG Intergenic
No off target data available for this crispr