ID: 987526229

View in Genome Browser
Species Human (GRCh38)
Location 5:19053427-19053449
Sequence GCACCTTGACCCATATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987526229_987526233 20 Left 987526229 5:19053427-19053449 CCCTGGGATATGGGTCAAGGTGC No data
Right 987526233 5:19053470-19053492 TTTGCTAGGAAAAATCAAGAAGG No data
987526229_987526234 21 Left 987526229 5:19053427-19053449 CCCTGGGATATGGGTCAAGGTGC No data
Right 987526234 5:19053471-19053493 TTGCTAGGAAAAATCAAGAAGGG No data
987526229_987526235 26 Left 987526229 5:19053427-19053449 CCCTGGGATATGGGTCAAGGTGC No data
Right 987526235 5:19053476-19053498 AGGAAAAATCAAGAAGGGAATGG No data
987526229_987526231 -7 Left 987526229 5:19053427-19053449 CCCTGGGATATGGGTCAAGGTGC No data
Right 987526231 5:19053443-19053465 AAGGTGCAAGTGACTTTTTGTGG No data
987526229_987526232 6 Left 987526229 5:19053427-19053449 CCCTGGGATATGGGTCAAGGTGC No data
Right 987526232 5:19053456-19053478 CTTTTTGTGGACGTTTTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987526229 Original CRISPR GCACCTTGACCCATATCCCA GGG (reversed) Intergenic
No off target data available for this crispr