ID: 987528682

View in Genome Browser
Species Human (GRCh38)
Location 5:19086161-19086183
Sequence GTCAATATACACATGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987528682_987528684 -2 Left 987528682 5:19086161-19086183 CCATTTTCCATGTGTATATTGAC No data
Right 987528684 5:19086182-19086204 ACTCTCTTTCTCGCTGTGTCAGG No data
987528682_987528687 5 Left 987528682 5:19086161-19086183 CCATTTTCCATGTGTATATTGAC No data
Right 987528687 5:19086189-19086211 TTCTCGCTGTGTCAGGGAGTGGG No data
987528682_987528685 -1 Left 987528682 5:19086161-19086183 CCATTTTCCATGTGTATATTGAC No data
Right 987528685 5:19086183-19086205 CTCTCTTTCTCGCTGTGTCAGGG No data
987528682_987528686 4 Left 987528682 5:19086161-19086183 CCATTTTCCATGTGTATATTGAC No data
Right 987528686 5:19086188-19086210 TTTCTCGCTGTGTCAGGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987528682 Original CRISPR GTCAATATACACATGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr