ID: 987535367 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:19180467-19180489 |
| Sequence | CTGATGATGAATAGGTAAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 987535363_987535367 | 30 | Left | 987535363 | 5:19180414-19180436 | CCACTAGGGTATTAGAGTCAGCT | No data | ||
| Right | 987535367 | 5:19180467-19180489 | CTGATGATGAATAGGTAAAAAGG | No data | ||||
| 987535364_987535367 | -7 | Left | 987535364 | 5:19180451-19180473 | CCTACACGCCTAATCTCTGATGA | No data | ||
| Right | 987535367 | 5:19180467-19180489 | CTGATGATGAATAGGTAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 987535367 | Original CRISPR | CTGATGATGAATAGGTAAAA AGG | Intergenic | ||
| No off target data available for this crispr | |||||