ID: 987535367

View in Genome Browser
Species Human (GRCh38)
Location 5:19180467-19180489
Sequence CTGATGATGAATAGGTAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987535363_987535367 30 Left 987535363 5:19180414-19180436 CCACTAGGGTATTAGAGTCAGCT No data
Right 987535367 5:19180467-19180489 CTGATGATGAATAGGTAAAAAGG No data
987535364_987535367 -7 Left 987535364 5:19180451-19180473 CCTACACGCCTAATCTCTGATGA No data
Right 987535367 5:19180467-19180489 CTGATGATGAATAGGTAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987535367 Original CRISPR CTGATGATGAATAGGTAAAA AGG Intergenic
No off target data available for this crispr