ID: 987552695

View in Genome Browser
Species Human (GRCh38)
Location 5:19404528-19404550
Sequence CACAGTCACCTCATTCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
987552695_987552699 19 Left 987552695 5:19404528-19404550 CCTCCATGAATGAGGTGACTGTG No data
Right 987552699 5:19404570-19404592 AAGTGCTGCTGTAAATTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
987552695 Original CRISPR CACAGTCACCTCATTCATGG AGG (reversed) Intergenic
No off target data available for this crispr